ID: 1013414337

View in Genome Browser
Species Human (GRCh38)
Location 6:109911606-109911628
Sequence CCCCTGTCTCTCAATTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013414335_1013414337 22 Left 1013414335 6:109911561-109911583 CCTGGGAAACGTCTTTTTGAAAT No data
Right 1013414337 6:109911606-109911628 CCCCTGTCTCTCAATTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013414337 Original CRISPR CCCCTGTCTCTCAATTACTG TGG Intergenic
No off target data available for this crispr