ID: 1013418691

View in Genome Browser
Species Human (GRCh38)
Location 6:109947161-109947183
Sequence CACCAGGTGCTGTAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013418686_1013418691 24 Left 1013418686 6:109947114-109947136 CCTACAGAGGCTCACCTTTAACA No data
Right 1013418691 6:109947161-109947183 CACCAGGTGCTGTAGCTGGAAGG No data
1013418688_1013418691 10 Left 1013418688 6:109947128-109947150 CCTTTAACATGCAGTGATGGAGC No data
Right 1013418691 6:109947161-109947183 CACCAGGTGCTGTAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013418691 Original CRISPR CACCAGGTGCTGTAGCTGGA AGG Intergenic
No off target data available for this crispr