ID: 1013420389

View in Genome Browser
Species Human (GRCh38)
Location 6:109961644-109961666
Sequence TGGAGCTGCTTTGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013420379_1013420389 10 Left 1013420379 6:109961611-109961633 CCCAAGCCTTGCCCCAAAGGCAG No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data
1013420385_1013420389 -2 Left 1013420385 6:109961623-109961645 CCCAAAGGCAGGAGGCAGAAATG No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data
1013420383_1013420389 4 Left 1013420383 6:109961617-109961639 CCTTGCCCCAAAGGCAGGAGGCA No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data
1013420380_1013420389 9 Left 1013420380 6:109961612-109961634 CCAAGCCTTGCCCCAAAGGCAGG No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data
1013420386_1013420389 -3 Left 1013420386 6:109961624-109961646 CCAAAGGCAGGAGGCAGAAATGG No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data
1013420384_1013420389 -1 Left 1013420384 6:109961622-109961644 CCCCAAAGGCAGGAGGCAGAAAT No data
Right 1013420389 6:109961644-109961666 TGGAGCTGCTTTGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013420389 Original CRISPR TGGAGCTGCTTTGGAAAAAC AGG Intergenic
No off target data available for this crispr