ID: 1013420865

View in Genome Browser
Species Human (GRCh38)
Location 6:109965589-109965611
Sequence ATTGAGACTACAGCCTGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013420865_1013420868 7 Left 1013420865 6:109965589-109965611 CCGTCACAGGCTGTAGTCTCAAT No data
Right 1013420868 6:109965619-109965641 TAGAAGCAGCTCATTTGGGCAGG No data
1013420865_1013420867 3 Left 1013420865 6:109965589-109965611 CCGTCACAGGCTGTAGTCTCAAT No data
Right 1013420867 6:109965615-109965637 TTGATAGAAGCAGCTCATTTGGG No data
1013420865_1013420866 2 Left 1013420865 6:109965589-109965611 CCGTCACAGGCTGTAGTCTCAAT No data
Right 1013420866 6:109965614-109965636 GTTGATAGAAGCAGCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013420865 Original CRISPR ATTGAGACTACAGCCTGTGA CGG (reversed) Intergenic
No off target data available for this crispr