ID: 1013422634

View in Genome Browser
Species Human (GRCh38)
Location 6:109979757-109979779
Sequence CTGCAGCGTGGTGCGCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013422627_1013422634 15 Left 1013422627 6:109979719-109979741 CCCGTGCTGGGCTGGAACTGCCT 0: 1
1: 2
2: 5
3: 43
4: 339
Right 1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013422628_1013422634 14 Left 1013422628 6:109979720-109979742 CCGTGCTGGGCTGGAACTGCCTG 0: 1
1: 1
2: 7
3: 61
4: 771
Right 1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013422630_1013422634 -5 Left 1013422630 6:109979739-109979761 CCTGGCAGAGCGCGCCGCCTGCA 0: 1
1: 0
2: 3
3: 10
4: 130
Right 1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013422623_1013422634 28 Left 1013422623 6:109979706-109979728 CCTGGGGCTGCTGCCCGTGCTGG 0: 1
1: 1
2: 5
3: 75
4: 519
Right 1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013422634 Original CRISPR CTGCAGCGTGGTGCGCCCGC TGG Exonic
900245977 1:1636242-1636264 CTGGAACGTGGTGAGCCAGCAGG + Intronic
900257202 1:1703385-1703407 CTGGAACGTGGTGAGCCAGCAGG + Intronic
900597692 1:3489967-3489989 CAGCAGCCTGGTGAGCCCGCAGG + Exonic
903373310 1:22850637-22850659 CTGCAGCCTGATGAGCCCACTGG + Intronic
903828602 1:26161795-26161817 CTGCGGCCTGGAGCGCGCGCTGG + Exonic
911612252 1:99970088-99970110 CGGCAGCCTGGGGCGCCCGGCGG + Intronic
912933286 1:113982721-113982743 CTCCAGCGTTGTGCTCCTGCAGG + Intergenic
918107104 1:181424797-181424819 CTGCAGCCTGGTGCTCAAGCCGG + Intronic
920298665 1:204975310-204975332 CTGCACCGTGGTGCCCCTTCTGG - Exonic
922616856 1:226965775-226965797 CCGCAGCGTGGTGCCCAGGCAGG - Intronic
922725286 1:227920172-227920194 CTGCCACGTGGTGGGCCAGCCGG - Exonic
923631021 1:235649690-235649712 CTGCAGCGCGGTGCTCGCGGGGG + Exonic
923674119 1:236065245-236065267 CTGCCCCGCGGCGCGCCCGCTGG - Intergenic
1073338715 10:102729411-102729433 CTGCAGCATGGTGGCCACGCGGG + Intronic
1075728614 10:124623308-124623330 CTGCAGCCTGGCGGGACCGCGGG - Exonic
1076820861 10:132938912-132938934 CTGCATCCTGGTGCTCCTGCAGG - Intronic
1077142467 11:1030603-1030625 GTGCAGCATGGTGGGCCAGCCGG - Exonic
1083418965 11:62542938-62542960 CAGTAGCGTGGTCCGACCGCTGG - Intronic
1083616340 11:64028403-64028425 CTGCAGCGTGGAGCCCAAGCTGG - Intronic
1084151597 11:67290100-67290122 CTCCAGTGGGGTCCGCCCGCGGG - Exonic
1104846955 12:131851624-131851646 CTGCTGCCTGGTGCTCCCGCCGG + Exonic
1119383196 14:74241294-74241316 CGGCAGCGGGGTGCGCGGGCAGG - Intronic
1121115489 14:91339871-91339893 GTGCACCGAGGTGCGTCCGCGGG - Exonic
1122216235 14:100206466-100206488 CTGGAGGGTGGTGTGCCAGCAGG + Intergenic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1122780379 14:104140961-104140983 CTGCAGGGTGCTGTGCCCCCGGG + Intronic
1129712447 15:77827306-77827328 CTGCAGCCTGGTGTGCCCAGTGG + Intergenic
1132314234 15:100879195-100879217 CTGGGCCGGGGTGCGCCCGCCGG + Intronic
1133022738 16:2974051-2974073 CTGCAGGGTGGTGAGCCAGGCGG + Exonic
1134687616 16:16169712-16169734 CTGCAGGGTCGTCCGCCCACAGG + Exonic
1139491120 16:67286551-67286573 CTCCTGCGTGGGGCCCCCGCAGG - Exonic
1140415429 16:74770858-74770880 CTGCAGCATGGCCCGCCCTCGGG + Intronic
1142472650 17:171992-172014 CTGCAGCCTGGCCCGGCCGCTGG - Intronic
1145878143 17:28335348-28335370 CTGCAGCGCGCTGCCGCCGCGGG - Exonic
1151568667 17:74915179-74915201 CCGCAGGGAGGTGCGCCCCCAGG + Intergenic
1160835756 19:1123774-1123796 CTGCAGCAAGGTGCTCCCCCAGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1163552565 19:17973909-17973931 TGGCAGCGTGGGGCGGCCGCTGG + Exonic
1165388899 19:35527315-35527337 CCGCAGCATGGTGGGCCCCCTGG + Exonic
1165388917 19:35527369-35527391 CCGCAGCATGGTGGGCCCCCTGG + Exonic
1165388962 19:35527531-35527553 CCGCAGCATGGTGGGCCCCCTGG + Exonic
1167309528 19:48729033-48729055 CAGCAGCGTGGCGGGCCCGAGGG + Exonic
1167586123 19:50376892-50376914 CTGCAGCGCGGTGCGGGGGCGGG + Intronic
1168100360 19:54138138-54138160 CTGCAGCGCGGGGCTCCCGGCGG + Intronic
925352364 2:3210373-3210395 CTGCAGCCTGGTGTGGCCGTGGG - Intronic
932419308 2:71592187-71592209 CTGCAGGGTGCTCGGCCCGCAGG - Intronic
932568571 2:72924671-72924693 GTGCAGCCTGCTGAGCCCGCAGG + Intronic
936011840 2:108930080-108930102 CTGGAGCCTGGTGCGCTCTCAGG - Intronic
942323933 2:174759550-174759572 CAGCAGCGTGGTGCGGCCAGTGG - Exonic
944512449 2:200477878-200477900 CTGCAGCGTGCTGCCTTCGCCGG - Exonic
948455333 2:238102060-238102082 CGGCAGCGTGGTGCAGCGGCCGG - Exonic
1168827099 20:821459-821481 CTGCAGCGTGGGGAGCCAGAGGG + Intergenic
1172075617 20:32294511-32294533 CTCTAGGGTGGTGCGCCTGCAGG - Intronic
1175701446 20:61140684-61140706 GTGCAGCGTGGTGGGCCTCCTGG + Intergenic
1176171299 20:63697535-63697557 CTGCAGTGTGCTGCCCCCTCAGG - Intronic
1180170813 21:46057233-46057255 GTGCACCGTGGTGGGCCCGAGGG - Intergenic
1180179683 21:46112369-46112391 CTGCAGCTTGATGCCCCCGCAGG - Exonic
1182771897 22:32802140-32802162 CTGCAGCGTGGGGCTCGGGCGGG - Intronic
962939662 3:140114347-140114369 CTGCCCCATGGTGCTCCCGCTGG + Intronic
972320467 4:37969066-37969088 CTCCAGCATGGTGGGCCTGCAGG - Intronic
973916148 4:55636423-55636445 CTGCAGGGTGGGGCGCGGGCAGG - Intronic
992991291 5:82286352-82286374 CTGCAGACTGGTGAGCCGGCAGG + Intronic
996738458 5:126777798-126777820 CTGCAGCTTGGCGCGCTCGCGGG - Exonic
997292404 5:132747405-132747427 CTGCAGCCTGGGGCGCCGCCGGG - Intergenic
999188707 5:149731118-149731140 CTGCATCGTGGAGCGCGCACCGG - Intronic
999372608 5:151064915-151064937 CTGCAGGGAGGGGCGCTCGCAGG + Intronic
1002277743 5:178114366-178114388 CTGCAGCCTGGTGGACCGGCAGG - Intronic
1008030460 6:46688377-46688399 CTGCCGCGTGGTCAGCCGGCAGG + Exonic
1013422634 6:109979757-109979779 CTGCAGCGTGGTGCGCCCGCTGG + Exonic
1019493026 7:1323883-1323905 CTCCAGCGTGGAGCGGCCGACGG + Intergenic
1019620369 7:1988839-1988861 CTGCAGCCTGGTGCGGGCACAGG - Intronic
1019745944 7:2700438-2700460 CTGCAGCATGGTGGGCGGGCAGG - Exonic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1025615736 7:63114512-63114534 CAGCAGCGTGGTGCGCAAGCCGG + Intergenic
1029701407 7:102248873-102248895 CTGCAGCGAGCTGGGCCTGCGGG - Exonic
1038596455 8:28890550-28890572 CTTCCGCGTGGGGCGCCCGTCGG - Exonic
1039854976 8:41404175-41404197 CTGCAGCGTGGTGGGGCTTCGGG - Intergenic
1045888103 8:107123418-107123440 CTGCAACGTGGTGAGCAGGCTGG - Intergenic
1049192063 8:141294073-141294095 CTGCAGCGTGGTGTGCCCAAGGG - Intronic
1055945180 9:81687416-81687438 CTGCAGCCTGGTGCGGCGTCTGG + Exonic
1061435152 9:130556549-130556571 CTGCTGCGTGGTGAGGCCACAGG + Intergenic
1061859285 9:133459923-133459945 CTGCGGCGAGGCGCGCCCGAAGG - Intergenic
1061861885 9:133472503-133472525 CTGCAGCCTGGTGGGCACGCAGG + Intronic
1061990584 9:134156654-134156676 GTGAAGCGTGGTGTGCCCGTAGG + Intronic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1062575583 9:137205761-137205783 CGGCATCGGGGTGCGCCCGGTGG - Exonic
1191830340 X:65408103-65408125 CTGCAGCCTGGTGCGGCGTCGGG - Intronic
1192635084 X:72808267-72808289 CTACAGCCTGGTGCTCCAGCAGG + Intronic
1192646631 X:72912536-72912558 CTACAGCCTGGTGCTCCAGCAGG - Intronic