ID: 1013423390

View in Genome Browser
Species Human (GRCh38)
Location 6:109987333-109987355
Sequence CAGGCTTGACAGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013423380_1013423390 30 Left 1013423380 6:109987280-109987302 CCACATAACTGGAAACACTGAAA No data
Right 1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013423390 Original CRISPR CAGGCTTGACAGGAGGAGGA TGG Intergenic
No off target data available for this crispr