ID: 1013427263

View in Genome Browser
Species Human (GRCh38)
Location 6:110024078-110024100
Sequence GACTCAGGCCTCACTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013427263_1013427269 6 Left 1013427263 6:110024078-110024100 CCTGGTTGAGTGAGGCCTGAGTC No data
Right 1013427269 6:110024107-110024129 GGTGGGCTCTGTCCCCACCATGG No data
1013427263_1013427270 7 Left 1013427263 6:110024078-110024100 CCTGGTTGAGTGAGGCCTGAGTC No data
Right 1013427270 6:110024108-110024130 GTGGGCTCTGTCCCCACCATGGG No data
1013427263_1013427274 20 Left 1013427263 6:110024078-110024100 CCTGGTTGAGTGAGGCCTGAGTC No data
Right 1013427274 6:110024121-110024143 CCACCATGGGCCTGCAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013427263 Original CRISPR GACTCAGGCCTCACTCAACC AGG (reversed) Intergenic
No off target data available for this crispr