ID: 1013428511

View in Genome Browser
Species Human (GRCh38)
Location 6:110035743-110035765
Sequence TCCCACAGTGTTGGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013428511_1013428516 -8 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG No data
1013428511_1013428517 14 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428517 6:110035780-110035802 GATCACTTGAGCCTAGAAGTTGG No data
1013428511_1013428520 26 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428520 6:110035792-110035814 CTAGAAGTTGGAGGCCAGCCTGG No data
1013428511_1013428518 17 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428518 6:110035783-110035805 CACTTGAGCCTAGAAGTTGGAGG No data
1013428511_1013428521 27 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428521 6:110035793-110035815 TAGAAGTTGGAGGCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013428511 Original CRISPR TCCCACAGTGTTGGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr