ID: 1013428516

View in Genome Browser
Species Human (GRCh38)
Location 6:110035758-110035780
Sequence CTGTGGGAGGTCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013428511_1013428516 -8 Left 1013428511 6:110035743-110035765 CCTGTTATTCCAACACTGTGGGA No data
Right 1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013428516 Original CRISPR CTGTGGGAGGTCAAGGTGGA AGG Intergenic
No off target data available for this crispr