ID: 1013431024

View in Genome Browser
Species Human (GRCh38)
Location 6:110054901-110054923
Sequence GAACCCCAGGGGCCATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013431017_1013431024 -7 Left 1013431017 6:110054885-110054907 CCTTCCCCAGCATGAGGAACCCC No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data
1013431013_1013431024 19 Left 1013431013 6:110054859-110054881 CCAGACAGAGTGTTCAAGAGCAG No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data
1013431010_1013431024 28 Left 1013431010 6:110054850-110054872 CCAGATGCCCCAGACAGAGTGTT No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data
1013431012_1013431024 20 Left 1013431012 6:110054858-110054880 CCCAGACAGAGTGTTCAAGAGCA No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data
1013431009_1013431024 29 Left 1013431009 6:110054849-110054871 CCCAGATGCCCCAGACAGAGTGT No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data
1013431011_1013431024 21 Left 1013431011 6:110054857-110054879 CCCCAGACAGAGTGTTCAAGAGC No data
Right 1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013431024 Original CRISPR GAACCCCAGGGGCCATCAGC TGG Intergenic
No off target data available for this crispr