ID: 1013434685

View in Genome Browser
Species Human (GRCh38)
Location 6:110091298-110091320
Sequence AGGGAAAAAGGAGGATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013434685_1013434689 -10 Left 1013434685 6:110091298-110091320 CCAACCAATCCTCCTTTTTCCCT No data
Right 1013434689 6:110091311-110091333 CTTTTTCCCTCCTTTCCAATTGG No data
1013434685_1013434695 14 Left 1013434685 6:110091298-110091320 CCAACCAATCCTCCTTTTTCCCT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434685_1013434690 -6 Left 1013434685 6:110091298-110091320 CCAACCAATCCTCCTTTTTCCCT No data
Right 1013434690 6:110091315-110091337 TTCCCTCCTTTCCAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013434685 Original CRISPR AGGGAAAAAGGAGGATTGGT TGG (reversed) Intergenic
No off target data available for this crispr