ID: 1013434686

View in Genome Browser
Species Human (GRCh38)
Location 6:110091302-110091324
Sequence AAGGAGGGAAAAAGGAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013434686_1013434690 -10 Left 1013434686 6:110091302-110091324 CCAATCCTCCTTTTTCCCTCCTT No data
Right 1013434690 6:110091315-110091337 TTCCCTCCTTTCCAATTGGAAGG No data
1013434686_1013434695 10 Left 1013434686 6:110091302-110091324 CCAATCCTCCTTTTTCCCTCCTT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013434686 Original CRISPR AAGGAGGGAAAAAGGAGGAT TGG (reversed) Intergenic
No off target data available for this crispr