ID: 1013434687

View in Genome Browser
Species Human (GRCh38)
Location 6:110091307-110091329
Sequence TTGGAAAGGAGGGAAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013434687_1013434698 30 Left 1013434687 6:110091307-110091329 CCTCCTTTTTCCCTCCTTTCCAA No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434687_1013434695 5 Left 1013434687 6:110091307-110091329 CCTCCTTTTTCCCTCCTTTCCAA No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013434687 Original CRISPR TTGGAAAGGAGGGAAAAAGG AGG (reversed) Intergenic
No off target data available for this crispr