ID: 1013434695

View in Genome Browser
Species Human (GRCh38)
Location 6:110091335-110091357
Sequence AGGTTTTTACATGCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013434685_1013434695 14 Left 1013434685 6:110091298-110091320 CCAACCAATCCTCCTTTTTCCCT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434688_1013434695 2 Left 1013434688 6:110091310-110091332 CCTTTTTCCCTCCTTTCCAATTG No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434687_1013434695 5 Left 1013434687 6:110091307-110091329 CCTCCTTTTTCCCTCCTTTCCAA No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434686_1013434695 10 Left 1013434686 6:110091302-110091324 CCAATCCTCCTTTTTCCCTCCTT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434692_1013434695 -6 Left 1013434692 6:110091318-110091340 CCTCCTTTCCAATTGGAAGGTTT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434693_1013434695 -9 Left 1013434693 6:110091321-110091343 CCTTTCCAATTGGAAGGTTTTTA No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data
1013434691_1013434695 -5 Left 1013434691 6:110091317-110091339 CCCTCCTTTCCAATTGGAAGGTT No data
Right 1013434695 6:110091335-110091357 AGGTTTTTACATGCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013434695 Original CRISPR AGGTTTTTACATGCTTTCTC TGG Intergenic
No off target data available for this crispr