ID: 1013434698

View in Genome Browser
Species Human (GRCh38)
Location 6:110091360-110091382
Sequence CCCTCCCTTTTTTTCGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013434693_1013434698 16 Left 1013434693 6:110091321-110091343 CCTTTCCAATTGGAAGGTTTTTA No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434691_1013434698 20 Left 1013434691 6:110091317-110091339 CCCTCCTTTCCAATTGGAAGGTT No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434692_1013434698 19 Left 1013434692 6:110091318-110091340 CCTCCTTTCCAATTGGAAGGTTT No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434687_1013434698 30 Left 1013434687 6:110091307-110091329 CCTCCTTTTTCCCTCCTTTCCAA No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434694_1013434698 11 Left 1013434694 6:110091326-110091348 CCAATTGGAAGGTTTTTACATGC No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data
1013434688_1013434698 27 Left 1013434688 6:110091310-110091332 CCTTTTTCCCTCCTTTCCAATTG No data
Right 1013434698 6:110091360-110091382 CCCTCCCTTTTTTTCGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013434698 Original CRISPR CCCTCCCTTTTTTTCGTCAT AGG Intergenic
No off target data available for this crispr