ID: 1013435554

View in Genome Browser
Species Human (GRCh38)
Location 6:110101938-110101960
Sequence GGTGCAATTGGAGGAGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013435554 Original CRISPR GGTGCAATTGGAGGAGGAGC TGG Exonic
900719622 1:4166832-4166854 GGAGGAGTTGGGGGAGGAGCAGG - Intergenic
901062021 1:6475956-6475978 AGTGGACTTGGAGGAGGAGGAGG - Exonic
901567541 1:10131053-10131075 GGGCCAGCTGGAGGAGGAGCCGG - Intronic
901963630 1:12847877-12847899 AGAGCAATGGGAGGAGGAGGAGG + Exonic
901984265 1:13061715-13061737 AGAGCAATGGGAGGAGGAGGAGG - Exonic
901991273 1:13115988-13116010 AGAGCAATGGGAGGAGGAGGAGG + Intergenic
901997545 1:13165055-13165077 AGAGCAATGGGAGGAGGAGGAGG + Exonic
902202287 1:14842848-14842870 GCTGGAATTGAAGGAGGAGAAGG - Intronic
902404550 1:16175616-16175638 GGTGGGATGGGAGGAAGAGCAGG - Intergenic
903050141 1:20594538-20594560 GGTGCTTTTGGAGGCCGAGCTGG + Intronic
903367530 1:22814385-22814407 GGTGCAGTGGGAGCAGGAGGCGG + Intronic
903391989 1:22971219-22971241 GCTGCATTTTGAGGAGGAGGGGG - Intergenic
904259929 1:29282685-29282707 GGTGATTGTGGAGGAGGAGCGGG + Exonic
904531445 1:31172347-31172369 GGAGCAATTTGAGGAGGTTCAGG - Intergenic
904575772 1:31504127-31504149 GGTGGAACTGGAGCAGGTGCTGG + Intergenic
905461709 1:38126557-38126579 GGTGCATTTGGGGGAGCAGCAGG + Intergenic
905885123 1:41487635-41487657 GGTGCAAGAGGAGGAGCAACTGG + Intergenic
906106770 1:43299480-43299502 GGTGGGATGGGAGTAGGAGCAGG - Intergenic
906684735 1:47756069-47756091 GATTCAATGGGAGGAGGAGATGG + Intergenic
906945482 1:50290856-50290878 GGAGACAATGGAGGAGGAGCAGG + Intergenic
907441962 1:54484412-54484434 GGAGGAAGGGGAGGAGGAGCAGG + Intergenic
908796237 1:67833421-67833443 GGAGCAAGAGGAGGAGGAGGAGG - Exonic
908859907 1:68472470-68472492 TGTGCAATTGGAGGCTGAGAAGG - Intergenic
909304776 1:74060314-74060336 GGTGGAAGAGGAGGAGGAGGAGG - Intronic
909835166 1:80245002-80245024 GGTGAAATTTGAGAAGTAGCAGG + Intergenic
911645154 1:100329805-100329827 GGTGCTATTGGAGGAAGAATAGG + Intergenic
911664575 1:100538971-100538993 GGTGGATGTGGAGGAGGAGTTGG - Exonic
912948223 1:114102433-114102455 GGTGCAACTGGAAGAAGAGGAGG - Intronic
912993437 1:114510935-114510957 GGTGCTGGTGGAGGAGGAGGAGG - Exonic
913100268 1:115557410-115557432 GGTGCAATTTGAGGTGCAGCTGG - Intergenic
914263618 1:146019632-146019654 GGAGCACTTCGAGGAGGAGGAGG - Exonic
915603723 1:156938151-156938173 TGTGCAATTGTGGGAGGGGCAGG - Intronic
916052890 1:161048526-161048548 GCAGCAACTGAAGGAGGAGCAGG - Exonic
919923872 1:202182145-202182167 AGTGCATTTGGAGGAGGAAGAGG - Intergenic
921411421 1:214840139-214840161 GATGCAGTTGGAGGAGGAGGAGG - Intergenic
921707973 1:218345793-218345815 GGAGCAAGAGAAGGAGGAGCAGG + Intergenic
921785900 1:219229380-219229402 GGGGCAATTGGAGGAAGGACAGG + Intergenic
922559902 1:226561743-226561765 GGGGAAGTTGGATGAGGAGCAGG + Intronic
922700354 1:227755845-227755867 GGGACAATTGGAGGAGAACCTGG + Intronic
922977918 1:229800652-229800674 GGTGGAGTTGGAGGGGCAGCAGG + Intergenic
923302140 1:232651155-232651177 GCTAGAATTCGAGGAGGAGCAGG - Intergenic
1065047802 10:21759487-21759509 GGTGGCAGCGGAGGAGGAGCAGG - Exonic
1065813496 10:29463893-29463915 GGGGCAAAGGGAGGAGGACCTGG - Intronic
1067723598 10:48749619-48749641 GGTGAAAGTGGAGCAGAAGCAGG + Intronic
1068203895 10:53822426-53822448 GGAGCAAGAGGAGCAGGAGCAGG + Exonic
1068203906 10:53822462-53822484 GGAGAAATAGGAGGAGGAGGGGG + Exonic
1068851883 10:61751516-61751538 AAAGGAATTGGAGGAGGAGCAGG + Intronic
1069813720 10:71180357-71180379 GGTGCTCTGGCAGGAGGAGCTGG - Intergenic
1070282463 10:75059667-75059689 GGTGCAGTGTGAGGAGGGGCAGG + Intergenic
1070792826 10:79199857-79199879 AAAGCAATTGGAGGAGGAACAGG + Intronic
1071344061 10:84674603-84674625 GGTGGAAGGGGAAGAGGAGCTGG + Intergenic
1073784303 10:106871732-106871754 GGTGTAATTGAAGGTGGAGTGGG + Intronic
1074389504 10:113045070-113045092 GGGAGTATTGGAGGAGGAGCAGG + Intronic
1074432348 10:113404653-113404675 GCTGCAATGTGAGGAGGATCTGG + Intergenic
1074865479 10:117542297-117542319 GGTGCTGGTGGAGGAGGAGGCGG + Intergenic
1075066295 10:119291226-119291248 GCTGCCATTGGAGGTGAAGCAGG + Intronic
1075302268 10:121335505-121335527 GATGAGATTGGAGGAGGAGGTGG - Intergenic
1076294708 10:129375475-129375497 GGTGCCCTTGGAGCAGGGGCTGG + Intergenic
1076456697 10:130604920-130604942 GGAGCTATGGTAGGAGGAGCAGG + Intergenic
1076516673 10:131049251-131049273 GGTGCAGTGGGAGGAGGGGCTGG - Intergenic
1076614502 10:131746839-131746861 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1076614513 10:131746890-131746912 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1076614517 10:131746905-131746927 GGAGGAGCTGGAGGAGGAGCAGG - Intergenic
1076614520 10:131746917-131746939 GGAGCAGGAGGAGGAGGAGCTGG - Intergenic
1076801619 10:132833653-132833675 GGGGCATCTGGAGGAGGAGGTGG - Intronic
1077461360 11:2712367-2712389 GGTGCAAATGGGGCAGGAACAGG + Intronic
1077537769 11:3132662-3132684 AGTGGAATTTGAGGAGGACCGGG - Intronic
1078080233 11:8198990-8199012 AGTGCAAAAGGAGGAGCAGCTGG - Intergenic
1078385654 11:10889884-10889906 GGTTCAAGAGGAGGAGTAGCAGG + Intergenic
1078469564 11:11576187-11576209 GGTGCAGTTGGTGCAGGAGCAGG - Intronic
1079156697 11:17954665-17954687 AGTGCCATTGGAGCAGGAGCAGG - Intronic
1079369379 11:19837382-19837404 GGGGAAATTTGAGGAGGAGCAGG + Intronic
1079491195 11:20990871-20990893 AGTGCAATTGGATGTTGAGCAGG - Intronic
1080648498 11:34204442-34204464 AGAGCACTTGGAGGAGGAGGAGG + Intronic
1081808081 11:45900815-45900837 GGTGAAAGTGGAGCAGGAGCAGG + Intronic
1083725117 11:64623848-64623870 GGTGAGATTGGAGCTGGAGCGGG - Intronic
1084050872 11:66599132-66599154 GGTGCACTTGGAGGACCAGATGG + Exonic
1084762420 11:71282551-71282573 GGTGCAATTGAATGAAGAGGGGG - Intergenic
1085311705 11:75520775-75520797 GGGGCAAAGGGAGGAGAAGCTGG + Intronic
1086267733 11:85021238-85021260 CGAGCAATAGGAGGAGGAGGAGG + Intronic
1091218811 11:133918941-133918963 GGGGCAGGGGGAGGAGGAGCGGG + Intronic
1091230471 11:133984774-133984796 GGTGCAAAGGGAGCAGGGGCCGG + Intergenic
1091562449 12:1625479-1625501 GGGGCAGGTGGAGGAGGAGCAGG - Intronic
1091744497 12:2982506-2982528 GGTGCACTTGGGGAAGGAGGAGG + Intronic
1092164921 12:6336735-6336757 GTTGAACTGGGAGGAGGAGCTGG - Intronic
1092255263 12:6923581-6923603 GGTGCAGCTGGAGGAAGAACAGG - Exonic
1093271769 12:17071573-17071595 GGAGTAATAGGAGGAGGAGAAGG - Intergenic
1094023468 12:25939137-25939159 GGTGCCTTTGGAAGAGGAGATGG - Intergenic
1094496369 12:30991923-30991945 GGGGCAGTTGGAAGAGGAGGTGG - Exonic
1095703703 12:45216348-45216370 GCTACAAATGGAGGAGGAGGAGG + Exonic
1096498864 12:52053773-52053795 CGTGAAAATGGAAGAGGAGCTGG - Intronic
1096524224 12:52201041-52201063 GCTGGAGTTGGAGGAGGAGGAGG - Intergenic
1097080219 12:56424841-56424863 GGTGCCAGTGGAGGAGCAGCGGG - Exonic
1097191143 12:57220243-57220265 GGTGGAGGTGGAGGAGGGGCAGG - Intronic
1100505024 12:95211189-95211211 GGTGCAATAGGAGGTGGGGCTGG + Exonic
1102098751 12:110261161-110261183 GGTGCAATGGGAGGCCGAGGTGG + Intergenic
1103800259 12:123533467-123533489 GGTGGCCATGGAGGAGGAGCGGG - Exonic
1104536130 12:129620048-129620070 GGATCACTTGGAGGATGAGCAGG - Intronic
1105068788 12:133221296-133221318 CGTGCAATTGGAGGAGGGTCTGG - Exonic
1105407687 13:20145510-20145532 GGGACACTTGGAGGAGAAGCAGG - Intronic
1107833822 13:44397801-44397823 TATGCAGTTGGAGGAGGCGCAGG + Intergenic
1110026107 13:70541659-70541681 GGTGAAGGTGGAGTAGGAGCTGG - Intergenic
1111615911 13:90661423-90661445 GGTGCATGTGGAGGATGTGCAGG - Intergenic
1112610798 13:100952907-100952929 GGTTCATGTGGAGGAGGAGGTGG - Intergenic
1113556829 13:111242715-111242737 GGTGCAGTGGCAGGAGGACCTGG + Intronic
1113954302 13:114089020-114089042 GCTGCCCTGGGAGGAGGAGCTGG - Intronic
1114142613 14:19932341-19932363 GGAGCAAGAGGAGGAGGAGGAGG - Intergenic
1114283143 14:21213070-21213092 CGAGCAATAGGAGGAGGAGGAGG + Exonic
1114502089 14:23177758-23177780 GGTGCAATTGCAGGAAGACTTGG - Intronic
1115422752 14:33216253-33216275 TGGGCATTTGGAGGAGGTGCAGG + Intronic
1117173822 14:53128454-53128476 GGTGGAAGTGGGGAAGGAGCAGG + Intronic
1117516807 14:56510035-56510057 GTTGAAATTGGAGGAGAGGCAGG + Intronic
1117761645 14:59035362-59035384 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1117785634 14:59281516-59281538 GCTGCTGTTGGAGGAGGAGGAGG + Intronic
1117980871 14:61340792-61340814 GGGAAAATGGGAGGAGGAGCAGG - Intronic
1118228506 14:63926220-63926242 GGTGAGATTGGAGGTGGAGATGG - Intronic
1118310116 14:64685896-64685918 GGTGCAGCTGGAGGTGGAGATGG - Intergenic
1118357597 14:65027490-65027512 GGTGGCTTTGGAGGAGGACCCGG + Exonic
1119072245 14:71598292-71598314 GGAGAAATGGGAGGAGAAGCAGG + Intronic
1119134893 14:72208374-72208396 TGAGGAATTGGAGGAAGAGCTGG - Intronic
1119954197 14:78777717-78777739 GGTGCCTTTGGAGGAAGAGAAGG + Intronic
1120160071 14:81136478-81136500 GGGGGAAATAGAGGAGGAGCAGG + Intronic
1120265132 14:82239054-82239076 AGTGCAATAGGGGGAGAAGCAGG + Intergenic
1120475291 14:84979070-84979092 AGTGCAATTCCAGGAGGTGCTGG - Intergenic
1121025465 14:90612854-90612876 GGTGCAATTGTAGGAGGTATGGG + Intronic
1122420372 14:101572673-101572695 TGTGCATATGGAGCAGGAGCCGG - Intergenic
1122426216 14:101607635-101607657 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
1122426307 14:101607981-101608003 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
1122593324 14:102871142-102871164 AGTGCTGTGGGAGGAGGAGCTGG - Intronic
1122616963 14:103025266-103025288 AGTGCAATTGGTGGGGGAGAGGG - Intronic
1122771012 14:104097648-104097670 GGTGCACGTGGAGGCGGGGCAGG + Intronic
1122876007 14:104665767-104665789 GGTGCAGTTTGAGGAGGGGAGGG - Intergenic
1122929119 14:104925383-104925405 GGTTCCATTGCAGGAGGAGGTGG + Intronic
1123681906 15:22769667-22769689 GGTGCGAAAGCAGGAGGAGCAGG - Intergenic
1123681966 15:22770021-22770043 GGTGCAGAAGCAGGAGGAGCAGG - Intergenic
1123707402 15:22960026-22960048 GGTGCACTTGGTGCAGGAGAAGG - Intronic
1123901534 15:24881981-24882003 GGTGGAAGTGGATGAGGAGAAGG - Intronic
1124013563 15:25858951-25858973 GGTGCTGCTGGAGGAGGACCTGG - Intronic
1124029740 15:25999625-25999647 GGAGGAATAGGAGGAGGAGGAGG - Intergenic
1124466966 15:29948929-29948951 GGTGGAGTTGGAAGAGGAGGAGG - Intronic
1124601423 15:31135798-31135820 GGTGGAAGAGGAAGAGGAGCCGG - Intronic
1125024788 15:35019397-35019419 ACTCCAGTTGGAGGAGGAGCGGG - Intergenic
1125325378 15:38531232-38531254 GGGACAATGGGTGGAGGAGCTGG + Intronic
1125721868 15:41849137-41849159 GGTGAAAGTGGAGGAGGGACTGG - Intronic
1126878233 15:53067072-53067094 GATGCAATTTGGGGATGAGCAGG - Intergenic
1128061463 15:64738362-64738384 GGTCTGAGTGGAGGAGGAGCCGG - Intergenic
1128737781 15:70063041-70063063 AGTGGAATTGGAGGGGGAGTGGG - Intronic
1129227455 15:74178432-74178454 GGTGCGCTTGTTGGAGGAGCAGG - Intergenic
1129685988 15:77686382-77686404 GGTGAACTTGCAGTAGGAGCTGG - Intronic
1130696992 15:86140698-86140720 AGTGCACTTGAAGGATGAGCTGG + Intergenic
1130817809 15:87458071-87458093 GGAGGAATTTGAGGAGGAGGAGG - Intergenic
1130993483 15:88890806-88890828 AGTGCAAGTGGAGGAGGTCCAGG - Intronic
1131085959 15:89575805-89575827 GGAGGACTTTGAGGAGGAGCTGG + Exonic
1131356175 15:91749150-91749172 GGTGGAAGTGGAGGTGGAGGTGG + Intergenic
1131356449 15:91750182-91750204 GGTGGAATTGGAGGAAGAGGTGG + Intergenic
1131675607 15:94667373-94667395 GGTGAAGGTGGAGGAGGAGGAGG - Intergenic
1132028046 15:98419579-98419601 GGAGAAAATGGAGGAGGAGGAGG + Intergenic
1132777742 16:1605163-1605185 GCTGGAAATGGAGGAAGAGCTGG + Intronic
1133221786 16:4322031-4322053 GGAGCACTTGGTGGAGGAGGGGG + Intronic
1134068166 16:11243071-11243093 CGAGCAATAGGAGGAGGAGGAGG - Intergenic
1134119270 16:11572182-11572204 GGTGGATTTGGAGGAGAGGCAGG - Intronic
1134625196 16:15718362-15718384 GGAGGAGCTGGAGGAGGAGCAGG - Exonic
1135562873 16:23489898-23489920 AGTACCCTTGGAGGAGGAGCAGG + Intronic
1135942437 16:26834256-26834278 GGAGCAATGGGAGGAGGAGGAGG + Intergenic
1137594528 16:49714935-49714957 GGTGGAATTTGAGGAGGGGAAGG + Intronic
1137978823 16:53053171-53053193 GGAGCAGAAGGAGGAGGAGCAGG - Intergenic
1137978835 16:53053241-53053263 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1138112660 16:54337103-54337125 GGTGGAAGTGGAGGAGGAGGAGG + Intergenic
1138678896 16:58671186-58671208 GGTGCCAGTGGAGGAGGACGTGG - Exonic
1139956747 16:70696913-70696935 GGGGCTCTTGGAGGGGGAGCTGG - Intronic
1140958636 16:79891433-79891455 GGTGCATTTGGGGAAGGAGCTGG - Intergenic
1141155528 16:81594078-81594100 GGAGGAAGAGGAGGAGGAGCGGG - Intronic
1141205207 16:81928083-81928105 GGTGCAATGGGAGGCAGAGCTGG + Intronic
1141680073 16:85538659-85538681 GGAGGAAGTGGAGGAGGAGAGGG + Intergenic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142317957 16:89361062-89361084 GGTGCCATTGCAGCAGGGGCTGG - Intronic
1142712005 17:1728448-1728470 GGTGCTAGAGGAGGAGGAGGGGG + Exonic
1143632345 17:8146433-8146455 GGTGGTATAGGAGGAGGAGGAGG + Exonic
1143714513 17:8757394-8757416 GGAGGAGCTGGAGGAGGAGCTGG - Exonic
1144025169 17:11271030-11271052 GGTGCAAATGGAGAGGCAGCAGG + Intronic
1144378516 17:14669546-14669568 GGAGCATTTGGAGGCTGAGCTGG - Intergenic
1145795563 17:27653576-27653598 GCTGAAATTGAATGAGGAGCAGG - Intergenic
1145809999 17:27758907-27758929 GCTGAAATTGAATGAGGAGCAGG - Exonic
1146008467 17:29177005-29177027 GGTGCACCTGGAAGAGCAGCAGG - Intronic
1147400610 17:40178167-40178189 GCTGCAGCTGGAGGAGGTGCCGG + Intronic
1147892077 17:43724550-43724572 TGTGCCATAGGAGGGGGAGCTGG + Intergenic
1147978417 17:44260719-44260741 GGTGCAACTGGAGGAGAACCTGG - Exonic
1148157663 17:45432769-45432791 GGGGCAAGTGGAGGCGAAGCCGG - Intronic
1148456013 17:47811756-47811778 GGTGCAGAAGGAGGAGGAGTGGG - Intronic
1148558616 17:48593290-48593312 GGTGAAATTGGCGCTGGAGCTGG + Exonic
1148836046 17:50466488-50466510 GGTGCCAGGGGAAGAGGAGCTGG - Intronic
1149580243 17:57744990-57745012 GGTGCAACAGGAGGAGCAGGCGG - Exonic
1149756831 17:59193642-59193664 GGTGGAGGTGGAGGAGGAGGAGG - Exonic
1149992395 17:61390315-61390337 GGTGATACTGAAGGAGGAGCAGG + Intronic
1151344953 17:73495767-73495789 GGTGGGCTGGGAGGAGGAGCAGG - Intronic
1152198455 17:78931133-78931155 GTTGCAATTGGAGAGGGTGCTGG - Intergenic
1152698560 17:81807956-81807978 CGTCGACTTGGAGGAGGAGCTGG - Intronic
1152752673 17:82071906-82071928 AGTGCAATGGCAGGAGGAGGAGG + Intergenic
1153448981 18:5205510-5205532 GGTGTGGCTGGAGGAGGAGCGGG + Intergenic
1153751082 18:8231337-8231359 GTGGCAATTGGGAGAGGAGCAGG - Intronic
1154107224 18:11533582-11533604 CGTGCCACTGGAGCAGGAGCAGG - Intergenic
1157382033 18:47227214-47227236 GGGGCAGGTGGAGGAGGAGGAGG - Intronic
1158251267 18:55489965-55489987 GGTGCGTGTGGAGAAGGAGCTGG - Intronic
1158579704 18:58671215-58671237 GGTGCAGCTGGAGGAGGAAGCGG - Intergenic
1158894635 18:61901366-61901388 GGTCCACTTGGATGAGGTGCAGG - Intergenic
1159265034 18:66069538-66069560 GGGACAACTGGATGAGGAGCTGG - Intergenic
1159637580 18:70824276-70824298 GGAGAAATTGGAGCAGGAGTAGG + Intergenic
1159796018 18:72844967-72844989 GGTGCACCTGGAGGAGAAGTGGG - Intronic
1159883712 18:73884321-73884343 AGTGCAATTCAAGGTGGAGCAGG - Intergenic
1160074116 18:75655585-75655607 GCTGCCTCTGGAGGAGGAGCGGG + Intergenic
1160208661 18:76858683-76858705 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208674 18:76858727-76858749 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208701 18:76858815-76858837 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208715 18:76858859-76858881 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208743 18:76858947-76858969 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208771 18:76859035-76859057 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208785 18:76859079-76859101 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208799 18:76859123-76859145 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208814 18:76859167-76859189 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208841 18:76859255-76859277 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160511670 18:79456520-79456542 GGGGCAGCTGGAGGAGGAGAGGG - Intronic
1161248631 19:3268897-3268919 GGGGCCATGGCAGGAGGAGCGGG + Intronic
1161990648 19:7682189-7682211 GGGGCAATGGGAAGGGGAGCAGG - Intronic
1162183271 19:8885391-8885413 GGTGCAATTGAAGGAGTTTCAGG + Intronic
1162469298 19:10862856-10862878 GGAGCAATTGGAGGAGAGCCTGG + Intronic
1162537136 19:11269501-11269523 GGTGGGACTGGAGGACGAGCAGG + Intergenic
1162815798 19:13193593-13193615 GGTTCAATTGGAGGAGGTCGAGG + Intergenic
1163547550 19:17948728-17948750 GGGGCGATGGGAGGGGGAGCTGG + Intergenic
1163692124 19:18743731-18743753 GGTGCAGGTGGCGGTGGAGCTGG - Intronic
1163758471 19:19120541-19120563 GGTGCAATCTGAGCAGGAGGCGG - Intronic
1163779615 19:19239583-19239605 GGAGGAATGGGAGGAGGAGAGGG - Intronic
1163779742 19:19240044-19240066 GGGGGAATGGGAGGAGGAGGGGG - Intronic
1163938410 19:20471449-20471471 GTTGCAATGGGAAGAGGAGAAGG + Intergenic
1164155628 19:22595551-22595573 GGTGCGGGAGGAGGAGGAGCTGG + Intergenic
1164567685 19:29339559-29339581 GGAGAAATAGGAGGAGGAGTAGG + Intergenic
1164798341 19:31054682-31054704 GGTGCTATGGGAAGATGAGCTGG + Intergenic
1164899820 19:31909012-31909034 GGTGCAAGAGAAGGAAGAGCTGG + Intergenic
1166268014 19:41696862-41696884 GGTTCAGATGGAGAAGGAGCAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166333377 19:42091320-42091342 GCTGCAAGTGGAGGAGGAGGAGG + Exonic
1166342727 19:42148619-42148641 GGGGCATTTGGAGGATGAGGAGG - Intronic
1166364324 19:42270741-42270763 GGTGCTGTGGGGGGAGGAGCAGG + Intronic
1167336690 19:48890744-48890766 CGTGCACCTGGAGGAGGAGGAGG - Intronic
1167390890 19:49194204-49194226 GGAGCAGGAGGAGGAGGAGCAGG - Intronic
1167571913 19:50293606-50293628 GGGGCAGTTGGAGGAAGAGCTGG + Exonic
1167637346 19:50662511-50662533 GGTGGACGTGGAGGAGGAGGAGG + Exonic
1168088419 19:54065254-54065276 GGTGGAAGAGGAGGAAGAGCAGG - Intergenic
1168451840 19:56472521-56472543 GGTGGAAGAGGTGGAGGAGCCGG - Intronic
925917146 2:8614902-8614924 GGGGCACTTGGAGAATGAGCAGG + Intergenic
925984524 2:9205938-9205960 GGTGCAGGAGGAGGAGGAGGGGG - Intergenic
926229446 2:10991721-10991743 GGTGGAAGAGGAGGAGGAGGAGG + Intergenic
927156624 2:20224710-20224732 GGTGCACGTGGAGGGGGAGGGGG - Intronic
927691715 2:25213178-25213200 GGCCCAGTTGGAGGAGGAGAGGG - Intergenic
927904102 2:26845091-26845113 GGGGCACTTCGAGGAGGAACAGG + Intergenic
928218919 2:29386350-29386372 GGTGCAATTGAAGGAAAAGGAGG + Intronic
929650973 2:43678731-43678753 GGTGGAAGTGGAGGTGGAGGTGG + Intronic
929819638 2:45262814-45262836 GGTGGACTGGGAGGAGGAGAAGG - Intergenic
931643132 2:64398919-64398941 GGAGGAAGTGGAGGAGGAGAAGG + Intergenic
935028877 2:99303332-99303354 GGTGCTTTTGTAGGTGGAGCTGG - Intronic
935138726 2:100332547-100332569 GCTGGAATTGGTGGTGGAGCTGG + Intergenic
935944974 2:108277443-108277465 GGAGCAGCTGGAAGAGGAGCTGG - Intergenic
936062689 2:109305925-109305947 GGGGCAGCTGGAGGAGCAGCTGG - Intronic
936604399 2:113935130-113935152 GGTGAAAGTGGTGGAGGACCAGG - Intronic
936919156 2:117670034-117670056 TGTGAAAGTGGAGGAGGAGGTGG + Intergenic
937513406 2:122625086-122625108 TTTACAATTGGAGCAGGAGCAGG + Intergenic
938786464 2:134634455-134634477 GGTGAGGGTGGAGGAGGAGCTGG - Intronic
939364534 2:141215212-141215234 GCTGTAGTTGAAGGAGGAGCAGG - Intronic
941384990 2:164841541-164841563 GCTGGAAAAGGAGGAGGAGCGGG + Intronic
941577244 2:167248488-167248510 GATGGAGTTGGAGGAGGAGGAGG - Exonic
942318461 2:174715202-174715224 GGTGCAACTGGAGGTGGGACAGG + Intergenic
943029833 2:182671982-182672004 GGCAGAATTCGAGGAGGAGCTGG - Intergenic
943601256 2:189923726-189923748 CGAGCAATAGGAGGAGGAGGAGG - Intronic
943890242 2:193277233-193277255 GGAGGAAGAGGAGGAGGAGCTGG - Intergenic
944499361 2:200342359-200342381 GGTGGTATTGGAGGAGGACCTGG + Intronic
944940059 2:204614781-204614803 GGTGAAGCGGGAGGAGGAGCAGG - Intronic
946307923 2:218866372-218866394 GGTGCATTTGGTCCAGGAGCAGG + Intronic
947885828 2:233570258-233570280 GGGGGAATTGGTGGAGGAGGTGG - Intergenic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948075287 2:235161180-235161202 GGTGCAATTTCCTGAGGAGCAGG - Intergenic
948715481 2:239858278-239858300 GATACAATGGGAGGAGGCGCTGG - Intergenic
948835669 2:240624873-240624895 GGTGGGCTTGGAGGAGGGGCCGG + Intronic
1169131744 20:3169332-3169354 GGTGCAATGTGGGGAGCAGCTGG + Intronic
1170779624 20:19412607-19412629 GGAGCAAGAGGAGGAGGAGGAGG + Intronic
1171012715 20:21517271-21517293 GGTGAAAGTGTAGGAGGGGCCGG - Intergenic
1171941175 20:31331269-31331291 GGAGCAGGAGGAGGAGGAGCAGG + Intergenic
1171941179 20:31331284-31331306 GGAGCAGGAGGAGGAGGAGCAGG + Intergenic
1172483928 20:35287410-35287432 GATGGAACTGGAGGAGGGGCCGG + Exonic
1172894788 20:38292765-38292787 GGTGCAATGGGAGGAGATGAGGG + Intronic
1173000323 20:39101081-39101103 GGTACAATTGGAGGAGGGGAGGG - Intergenic
1174150371 20:48482151-48482173 GGAGGAAGAGGAGGAGGAGCAGG + Intergenic
1174272113 20:49377187-49377209 GGTGCAGATGAAGGAGGAGTGGG + Intronic
1175033240 20:55975450-55975472 GGTGCAAGAACAGGAGGAGCAGG - Intergenic
1175501298 20:59452957-59452979 GGTGCAGCTGGAGGAGGTGCAGG + Intergenic
1175853253 20:62104900-62104922 GGTGGAATGGGAAGAGGAGGTGG + Intergenic
1178400180 21:32278795-32278817 GGCGCAGCTGGAGGAGGAGGCGG - Exonic
1178713168 21:34938499-34938521 GGTGTAAGAGGAGGAGGAGGAGG - Intronic
1178930553 21:36814909-36814931 GGTGCAATGGGTGGAGAAGCAGG + Intronic
1179231670 21:39509333-39509355 GGTGGAAAAGGACGAGGAGCAGG - Intronic
1180050726 21:45329909-45329931 GGTGGAATTCCAGGTGGAGCTGG - Intergenic
1180921169 22:19522441-19522463 GTTGCCATGGGAGGAGGTGCTGG - Intergenic
1182107050 22:27697117-27697139 GGTGCAGATGGAGGAAGAACAGG - Intergenic
1182313089 22:29423248-29423270 GGTGCAGAGGGAGGAGGAGAAGG + Intergenic
1182548223 22:31087609-31087631 GGAGCTATTGTAGGAGGAGGAGG - Intronic
1182710245 22:32318101-32318123 GGAGCAGTGGGAGGAGGAGGAGG - Intergenic
1182737313 22:32540084-32540106 TGTGAAACTGGAGGAGGTGCAGG - Intronic
1183184787 22:36285705-36285727 GGAGGAGCTGGAGGAGGAGCAGG - Exonic
1183186287 22:36293376-36293398 GGAGCAGCTGGAGGAGGAGGAGG - Exonic
1183248717 22:36713165-36713187 GGTGCAAGTGAAGGAGGTGTTGG + Intergenic
1183369001 22:37421923-37421945 GGGGCAATTGTAGGGGGAGAAGG + Intronic
1184089345 22:42284092-42284114 GGTGGAGATGGAGGAGCAGCGGG + Intronic
1184715928 22:46281829-46281851 GGTGCAGGTGGAGGAGGAGAGGG - Intronic
1185041576 22:48507052-48507074 TGTGCAGTTGGAGAAGGAGATGG + Intronic
1185041627 22:48507292-48507314 TGTGCAGTTGGAGGAGTGGCCGG + Intronic
949183665 3:1165319-1165341 GGTGTAATGGGAGGAAGAGTGGG - Intronic
950080262 3:10216832-10216854 GGTGGCGTTGGAGGAGGAGAGGG + Intronic
950575968 3:13832238-13832260 GGAGCAAGAGGAGGAGGAGGGGG - Intronic
950898491 3:16475138-16475160 TGTGCAAGTGGAAGGGGAGCTGG - Intronic
951455802 3:22890896-22890918 GGAGAAAGTGGAGGAGGAGGAGG - Intergenic
951803866 3:26624567-26624589 GGTGCGATTTGTGGAGGGGCGGG - Intronic
951851139 3:27141186-27141208 GGTGCAAGTGGAGACGGAGTTGG - Intronic
952925218 3:38315246-38315268 GCTGCAATTGGGTGAGGAGGTGG + Intronic
952927975 3:38335829-38335851 GGAGAAATAGGAGGAGGAGGAGG - Intergenic
953061808 3:39434067-39434089 GGTGCACCTGGAGAATGAGCAGG - Intergenic
953810134 3:46105056-46105078 GGATGAATTGGAGAAGGAGCAGG - Intergenic
954145855 3:48633987-48634009 GGGGCAGCTGGAGGAGGACCTGG - Intronic
954872961 3:53781496-53781518 TGTGCAAGCAGAGGAGGAGCTGG + Intronic
957054390 3:75433036-75433058 GGTGCAATTGGATGAGTCACAGG + Intergenic
957275096 3:78080878-78080900 GGTGGAATGGGAGGAGCAGATGG - Intergenic
957828743 3:85487504-85487526 GGAGGAAGTGGAGGAGGAGAAGG + Intronic
957828761 3:85487573-85487595 GGAGGAAGTGGAGGAGGAGAAGG + Intronic
957828767 3:85487594-85487616 GGAGGAAGTGGAGGAGGAGGAGG + Intronic
958059985 3:88467192-88467214 GGAGGAAGTGGAGGAGGAGGTGG - Intergenic
961428727 3:126865051-126865073 GGTGGAAAAGGAGGAGGAGGAGG - Intronic
961428759 3:126865171-126865193 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
961434822 3:126909651-126909673 GGGGCAGCTGGAGGAGGAGGAGG + Intronic
961650942 3:128416358-128416380 GGTGGGATTGGAGTTGGAGCTGG - Intergenic
961657627 3:128452172-128452194 GTTGCGGGTGGAGGAGGAGCTGG - Intergenic
961858039 3:129892926-129892948 GGTGGGATGTGAGGAGGAGCTGG - Intronic
962262299 3:133919612-133919634 TGTGCTATTAGAGGAGGAGTAGG + Intergenic
963777038 3:149450177-149450199 GGTGTACTTGAAGGAGGAGTAGG - Intergenic
964402177 3:156311021-156311043 GGTGCAAGTGAAAGAGGAGATGG + Intronic
964570769 3:158105774-158105796 GGTGTAGGAGGAGGAGGAGCAGG - Exonic
964995979 3:162881796-162881818 GGTGGAATGGGAGGGGAAGCAGG - Intergenic
966891810 3:184412702-184412724 GGGGCAATAGGAGGAAGAGGAGG - Intronic
967085081 3:186087505-186087527 GGTGCTATTTGATGAGGACCAGG - Intronic
967130992 3:186470565-186470587 GGTGCAATTTCTGGAGCAGCTGG + Intergenic
968502961 4:959706-959728 CATGCACGTGGAGGAGGAGCTGG - Exonic
974023119 4:56709134-56709156 GGTGCAGAGGGAGGAGGAGTTGG + Intergenic
976589407 4:86834244-86834266 GGTGGAAGGGGAAGAGGAGCAGG - Intronic
981807280 4:148731398-148731420 GGAGGAAGTGGAGGAGGAGAAGG + Intergenic
982504161 4:156196953-156196975 GGGGCCATTGGAGGAGAATCTGG + Intergenic
982842704 4:160211933-160211955 GTTGAATTTGGAGAAGGAGCAGG + Intergenic
982947766 4:161647988-161648010 GGGGCAATTGGAGGAGAGCCCGG + Intronic
983759230 4:171384838-171384860 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
986392635 5:7300406-7300428 GGTGCGAAAGCAGGAGGAGCAGG - Intergenic
987331343 5:16860236-16860258 GGGGCTATGGGAGGAGGGGCTGG - Intronic
988087990 5:26496593-26496615 GGAGAAGGTGGAGGAGGAGCAGG + Intergenic
988314754 5:29610395-29610417 GGAGGAAGTGGAGGAGGAGTTGG - Intergenic
992732872 5:79690027-79690049 GGCGGAGTCGGAGGAGGAGCCGG + Exonic
992784392 5:80155854-80155876 GGTGCAATGGAAGGAGGCTCTGG + Intronic
993502172 5:88676374-88676396 GGTGGAAGAGGAGGAGGAGGAGG - Intergenic
994172093 5:96668966-96668988 GGTGCTACTGGAGGAGGGGGTGG + Intronic
994517897 5:100793942-100793964 TCTGAAATTGGAGCAGGAGCAGG - Intergenic
996544100 5:124659448-124659470 GGAGCAAAGGAAGGAGGAGCAGG + Intronic
996663175 5:126027646-126027668 GGTGCTGGTGGAGGTGGAGCTGG - Intergenic
997823853 5:137089108-137089130 GGTGCAAGGGGAGGAGGAGGGGG + Intronic
998452077 5:142242472-142242494 GGTGGAAGTTGAAGAGGAGCTGG - Intergenic
999652080 5:153777569-153777591 GGTCTAATGGGAGGAGGAGAGGG - Intronic
1000380723 5:160627010-160627032 GGTGCAATCTGAGGAGGAGGAGG - Intronic
1000881334 5:166701100-166701122 GGTGGAAGAGGAGGAGGAGAAGG + Intergenic
1002105635 5:176878249-176878271 GGTGCAGCTGGAGAAGCAGCTGG + Exonic
1004872604 6:19922478-19922500 GGAGAAATTGTAGGAGGAGAAGG + Intergenic
1006603480 6:35241085-35241107 GATGGAGTTGGAGGAGGAGCCGG - Intronic
1006614955 6:35319855-35319877 GATGCAGCTGAAGGAGGAGCAGG + Exonic
1006911181 6:37564676-37564698 GGTTACATGGGAGGAGGAGCAGG - Intergenic
1007064383 6:38975082-38975104 GGTGATGTTGGAGGAGGAGGAGG + Intronic
1007181523 6:39932421-39932443 GGTGAAATTGGAGGCGAAACTGG + Intronic
1007870684 6:45034149-45034171 GCTGCTGTTGGAGGAGGAGGAGG - Intronic
1008288373 6:49682481-49682503 GGAGGAATAGGAGGAGGAGGAGG - Intergenic
1008305061 6:49890486-49890508 GGGGCTAAGGGAGGAGGAGCAGG + Intergenic
1011615357 6:89193038-89193060 AGTGCAGTGGGTGGAGGAGCAGG - Intronic
1011669380 6:89668054-89668076 GGTGGAATTGGAGAAGGCGAGGG - Exonic
1012981087 6:105831108-105831130 GGGGCAGCTGGAGGAGGAGAAGG + Intergenic
1012981130 6:105831218-105831240 GGGGCAGCTGGAGGAGGAGAAGG + Intergenic
1013130934 6:107232005-107232027 GGTACAATAGGAGCTGGAGCTGG - Intronic
1013435554 6:110101938-110101960 GGTGCAATTGGAGGAGGAGCTGG + Exonic
1013435561 6:110101974-110101996 GGGGCAATCTGAAGAGGAGCTGG + Exonic
1016390595 6:143570729-143570751 TGTGCAAGTGGAGAAGTAGCAGG + Intronic
1016466104 6:144327196-144327218 GGGGAAATGGGAGGAGGAGAAGG + Intronic
1018384781 6:163292239-163292261 TGTGAAAGTGCAGGAGGAGCTGG - Intronic
1019379636 7:714087-714109 GGAGTAATTGGAGGAGGAGGAGG - Intronic
1019652842 7:2169920-2169942 GGGGCACTTGGAGCAGGGGCTGG + Intronic
1019856250 7:3611362-3611384 GGTGCAAGAGGAGGAAGAGCAGG - Intronic
1019922098 7:4169476-4169498 GCTGCCCTTGGAGGAGGAGGCGG - Intronic
1019998484 7:4740816-4740838 CCTGCAACAGGAGGAGGAGCGGG - Exonic
1020026828 7:4905397-4905419 GGAGGAAGTGGAGGAGGAGGAGG + Intergenic
1020334781 7:7054598-7054620 GGAGCGGGTGGAGGAGGAGCAGG + Intergenic
1022793643 7:33714524-33714546 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1022793672 7:33714680-33714702 GGAGCAGGAGGAGGAGGAGCAGG - Intergenic
1022793676 7:33714695-33714717 GGAGCAGAAGGAGGAGGAGCAGG - Intergenic
1022793683 7:33714728-33714750 GGAGAAAGAGGAGGAGGAGCAGG - Intergenic
1022793722 7:33714932-33714954 GGAGAAAGAGGAGGAGGAGCAGG - Intergenic
1022793740 7:33715016-33715038 GGAGCAAAAGGAGGAGGAGGAGG - Intergenic
1023322714 7:39016727-39016749 GGTGAGATTGAAGGAGGAGCTGG + Intronic
1023517285 7:41014418-41014440 TGTGAAATTGGAGAAGGAGGAGG - Intergenic
1024106727 7:46096493-46096515 GGGGCAGTGGGAGGAGGAGGAGG - Intergenic
1025228211 7:57181581-57181603 TGTGAAAGTGGAGGAGGAGGAGG - Intergenic
1025228490 7:57183010-57183032 GTTGGAGTTGGAGGAGGAGGAGG - Intergenic
1029259521 7:99292371-99292393 GGAGCAGCTGGAGGAGGAGCAGG + Intergenic
1029588981 7:101494736-101494758 GCTGGGACTGGAGGAGGAGCGGG - Intronic
1031153796 7:118085524-118085546 GTTGAAAATGGAGGAGGAGTAGG - Intergenic
1033773706 7:144582675-144582697 GGAGCCATTGGAGGTGCAGCTGG - Intronic
1033926249 7:146464601-146464623 TGTGGAATTGGAGGAGGAGAAGG - Intronic
1035724381 8:1815427-1815449 GGTGGAAGGGGAAGAGGAGCCGG + Intergenic
1035729381 8:1843721-1843743 GATGCAATCGGAGATGGAGCGGG + Intronic
1035856338 8:2980330-2980352 GGAGGAAATGGAGGAGGAGGAGG - Intronic
1036545552 8:9766361-9766383 TATGGAATTGGAGGAGGAACAGG + Exonic
1036561276 8:9902294-9902316 GGAGGAAATGGAGGAGGGGCAGG - Intergenic
1036612527 8:10362647-10362669 GGAGAAATTGGTGGGGGAGCAGG - Intronic
1036702696 8:11023604-11023626 GGGGCCACTTGAGGAGGAGCTGG + Intronic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1036821989 8:11948266-11948288 TGTGTAAGTGGAGGAGGAGAGGG - Intergenic
1037497078 8:19450301-19450323 GGAGGAATAGGAGGAGGAGGAGG + Intronic
1038248584 8:25881881-25881903 GGGGCAGTTGGAGGAGAACCTGG + Intronic
1038522548 8:28245666-28245688 TGTTGAATTGGAGGAGGGGCCGG - Intergenic
1039986286 8:42451125-42451147 GCTGCAACTGGAGGAGGAACAGG + Intronic
1041803799 8:61828013-61828035 AGTGCACTTGTAGGAGGAGGAGG + Intergenic
1045395646 8:101758250-101758272 TGTGGAGTTGGAGCAGGAGCGGG - Intronic
1046013387 8:108577025-108577047 GGAGAAATTGTAGGAGAAGCAGG - Intergenic
1047409945 8:124616062-124616084 GGTTCAGTTGGAGGCGGAGGTGG - Intronic
1047654972 8:126967448-126967470 GATGAAGATGGAGGAGGAGCAGG + Intergenic
1047894604 8:129352775-129352797 GGTGAAAATGAAGGAGGAGGAGG - Intergenic
1048234125 8:132674048-132674070 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1048234129 8:132674063-132674085 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1048234133 8:132674078-132674100 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1048234137 8:132674093-132674115 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1048603205 8:135941096-135941118 GGAGTGATAGGAGGAGGAGCAGG + Intergenic
1048874330 8:138825128-138825150 TGTGCAATTGGAGATGGAGTTGG + Intronic
1049724533 8:144139492-144139514 GGAGCAGTTGGAGCGGGAGCTGG + Exonic
1050944578 9:11500901-11500923 GGGGCAATTGGAGGAGAGCCTGG - Intergenic
1051306105 9:15711669-15711691 TATGCAATTGTGGGAGGAGCTGG + Intronic
1051418565 9:16869804-16869826 AGTGCAAGTGGTGGAGGAGATGG - Intronic
1051581196 9:18676781-18676803 GGTGTAATTTGAGATGGAGCAGG - Intronic
1051769110 9:20557166-20557188 GGTGGAATTTGAGGAGGACTGGG - Intronic
1052549681 9:29932024-29932046 GATGAAAGTGAAGGAGGAGCAGG + Intergenic
1052998832 9:34566142-34566164 GCTGCAATGGGAGGAGGGGGTGG - Intronic
1053269413 9:36739944-36739966 GGTGCCATGGGAGGAGGAAGGGG - Intergenic
1054711812 9:68518010-68518032 GGTCCAGGTGGAGGAGGATCTGG + Intronic
1055651220 9:78409182-78409204 GGACGAATTGGAGGAGGAGGAGG + Intergenic
1056672558 9:88642864-88642886 GGAGAACTTGGAGGAGGAGAAGG - Intergenic
1057227958 9:93302377-93302399 GCTGCAAGTAGAGGAGGAGCAGG + Intronic
1057762796 9:97890152-97890174 GGTGCAGTGGGAAGAGTAGCTGG + Intergenic
1058800377 9:108539728-108539750 GATGCAATTTCAGGAGGATCTGG - Intergenic
1059342123 9:113603187-113603209 GGTGCTATTGCAGCAGGAACTGG + Intergenic
1060101836 9:120847366-120847388 GTTGCCATTGGAGGGGGAGTGGG + Intergenic
1060161526 9:121369658-121369680 GGTGGGATTGGGGGAGGAGGGGG + Intronic
1060172887 9:121476281-121476303 GGTGCAAATGGAGGTGCAGCTGG - Intergenic
1061865761 9:133491076-133491098 GGAGGAGTTGGAGGAGGAGGGGG + Intergenic
1061874246 9:133536016-133536038 GATGGAATTGGGGGAGGGGCAGG - Intronic
1062196446 9:135276717-135276739 GCTGCAATGGGAGCAGGAGGAGG - Intergenic
1062326286 9:136014059-136014081 GGTGGAGGGGGAGGAGGAGCTGG + Intronic
1062425436 9:136504023-136504045 CTTGCAGTTGGAGGAGGAGCTGG - Intronic
1062500311 9:136849296-136849318 GGTACAATTGGCTGAGGCGCTGG + Exonic
1062540640 9:137040285-137040307 GGTGGAAATGGAGGTGGAGGTGG + Intronic
1203779977 EBV:95920-95942 GGTGGAACAGGAGCAGGAGCAGG + Intergenic
1185566649 X:1099929-1099951 GGAGAAAATGGAGGAGGAGGAGG + Intergenic
1186363745 X:8870386-8870408 GGAGGATGTGGAGGAGGAGCAGG + Intergenic
1186517665 X:10178397-10178419 TCTGCATTTGGAGGAGTAGCAGG - Intronic
1188137300 X:26505188-26505210 GGTGAAATGGGAGGGGGAGCTGG - Intergenic
1190084186 X:47381012-47381034 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1190171002 X:48111626-48111648 GCTGTAAATGGAGAAGGAGCAGG + Intergenic
1190340674 X:49292908-49292930 GGCTCAAGAGGAGGAGGAGCAGG + Intronic
1190485492 X:50919435-50919457 GGTGCAAAAGGAGCAGGAGCAGG + Intergenic
1191590098 X:62873050-62873072 GGAGCAAATGGTGAAGGAGCTGG - Intergenic
1191797288 X:65034829-65034851 GGCGCCAGAGGAGGAGGAGCAGG + Intergenic
1192483330 X:71503797-71503819 GGTGGTAGTGGAGGAGGAGGAGG - Intronic
1192630833 X:72777000-72777022 GGAGCAGGAGGAGGAGGAGCAGG - Intronic
1192639075 X:72846111-72846133 GGTGGAGGGGGAGGAGGAGCAGG + Intronic
1192642637 X:72874697-72874719 GGTGGAGGGGGAGGAGGAGCAGG - Intronic
1192650876 X:72943801-72943823 GGAGCAGGAGGAGGAGGAGCAGG + Intronic
1194644311 X:96439987-96440009 TGGGCAATCGGAGGATGAGCAGG + Intergenic
1195577560 X:106468181-106468203 GGAGGAATTTGAGGAGGAGGAGG - Intergenic
1195954838 X:110317970-110317992 GCTGCAGTGGGAGGAGGAGGAGG + Exonic
1197832164 X:130654926-130654948 GGAGTTATTGGAGGAGGAGAGGG - Intronic
1198312239 X:135434618-135434640 GGACCGATTGGAGGAAGAGCAGG + Intergenic
1198313052 X:135438602-135438624 GGTGCACTAGCTGGAGGAGCAGG + Intergenic
1198474777 X:136984493-136984515 GGTGGAGTTGCAGGAGGAGATGG + Intergenic
1198576929 X:138020764-138020786 GGAGAAAGAGGAGGAGGAGCAGG + Intergenic
1199138305 X:144279585-144279607 CATGAAATTGGAGGAGGAGGAGG + Intergenic
1199179857 X:144841164-144841186 CGAGCAATGGGAGGAGGAGGAGG - Intergenic
1199996425 X:153029364-153029386 GGTGCAGGTGAGGGAGGAGCTGG + Intergenic
1200002332 X:153068505-153068527 GGAGGAATAGGAGGAGGAGGAGG + Intergenic
1200005392 X:153081505-153081527 GGAGGAATAGGAGGAGGAGGAGG - Intergenic
1201504973 Y:14688104-14688126 GGTGACATTGGAGGATGAGCTGG + Intronic
1201513066 Y:14786919-14786941 GGAGGAAGAGGAGGAGGAGCAGG - Intronic