ID: 1013437570

View in Genome Browser
Species Human (GRCh38)
Location 6:110126831-110126853
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 2, 1: 1, 2: 1, 3: 42, 4: 425}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013437570_1013437573 -10 Left 1013437570 6:110126831-110126853 CCTGTCTCCTTCTCCCTAATCTG 0: 2
1: 1
2: 1
3: 42
4: 425
Right 1013437573 6:110126844-110126866 CCCTAATCTGCCTCTTTCACTGG No data
1013437570_1013437576 4 Left 1013437570 6:110126831-110126853 CCTGTCTCCTTCTCCCTAATCTG 0: 2
1: 1
2: 1
3: 42
4: 425
Right 1013437576 6:110126858-110126880 TTTCACTGGCCTTTATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013437570 Original CRISPR CAGATTAGGGAGAAGGAGAC AGG (reversed) Intronic
900321793 1:2088178-2088200 CAGATGAGGGAGGCGGAGTCTGG - Intronic
900684611 1:3940127-3940149 CAGTTTAGAGATAAGGAAACAGG + Intergenic
901409849 1:9075073-9075095 CTAATTAGGGAAAAGGAGTCAGG + Intronic
901458048 1:9375023-9375045 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
901670613 1:10854102-10854124 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
901738784 1:11328944-11328966 CAGATGAGAGTGAAGGAGTCAGG - Intergenic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
902213183 1:14918202-14918224 CAGAATAGGGAGAACAAGATGGG + Intronic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
903186552 1:21632530-21632552 CAGATCAGGGATAAGAACACAGG + Intronic
903279487 1:22242391-22242413 GAGATTTGAGAGATGGAGACAGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903660196 1:24972428-24972450 CATATTACTGAGAAGGAAACAGG + Intergenic
903895493 1:26600752-26600774 AAGATTAGGGAGAAACAGCCGGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
905040365 1:34951776-34951798 CAGAATAGAGAGGAAGAGACAGG - Intergenic
905297330 1:36962473-36962495 TAGATTCAGGGGAAGGAGACAGG + Intronic
905651929 1:39662375-39662397 CAGGCTAGGGAGCAGGAGAATGG - Intronic
906199918 1:43953361-43953383 TAGGTTTGGGGGAAGGAGACAGG - Intronic
907561781 1:55397648-55397670 AAAATTAGGGGGAAGGAGAGGGG - Intergenic
908071324 1:60463437-60463459 CAGATTGGCCAGAAGAAGACAGG + Intergenic
908828577 1:68157054-68157076 CAGAATTGGGAGAAGGACATGGG + Intronic
909905831 1:81193448-81193470 CAGATGAGGGAGGTGGAGAAAGG - Intergenic
910336598 1:86139159-86139181 AAGATGAGGGAGAAGGAGAAAGG + Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911441621 1:97934237-97934259 AAGATTGGGGGAAAGGAGACTGG - Intergenic
911550689 1:99275893-99275915 CACAGTAGGGAGAGGGAGAGGGG + Intronic
911846708 1:102762058-102762080 CAGATAAGGGAGTATGAGTCAGG - Intergenic
914806754 1:150997455-150997477 GAGAGTAGGGAGAGGAAGACAGG + Intronic
915721826 1:157991610-157991632 AAGATTAGGGAGAGGGAGAGAGG - Intergenic
916146976 1:161748885-161748907 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
916188586 1:162157153-162157175 ATGATGAGGGAAAAGGAGACTGG - Intronic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
916649631 1:166822685-166822707 AAGTTTAAGGAGAAGGAGAGAGG + Intergenic
917226644 1:172790735-172790757 CAGATTTGGGAGAGTGAGCCTGG + Intergenic
917471639 1:175330805-175330827 CAGATTAGAGAGAAAGGGACTGG - Intronic
917763297 1:178188249-178188271 GAGTTTAGGGAGACTGAGACTGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918463826 1:184801682-184801704 CACAGTAGAGAGCAGGAGACAGG - Intronic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920236846 1:204513140-204513162 CAGATTAGGGAACTGAAGACCGG + Intergenic
921266117 1:213421868-213421890 CACACTAGGCAGAGGGAGACGGG - Intergenic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921719252 1:218452287-218452309 ATGATTAGGGAGAAGAAGAATGG - Intergenic
922484259 1:225960918-225960940 AAAATTAGGGAGACTGAGACAGG + Intergenic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
922790259 1:228307288-228307310 CAGAGTCTGGAGCAGGAGACAGG + Exonic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
924131859 1:240917673-240917695 CAGAGAAGGCAGAAAGAGACAGG + Intronic
924209729 1:241752394-241752416 GACATGAGGGAGAAGGAGATGGG - Intronic
924701980 1:246463343-246463365 CAGGTCAGGGAGAGGGAGAGAGG + Intronic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063161424 10:3421553-3421575 AAGCTTAGGGAGAAAGAGATAGG + Intergenic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1067211752 10:44265377-44265399 CAGATTGGGTAGAAGAAGATAGG + Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068189718 10:53635487-53635509 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068724056 10:60280984-60281006 CAGATTAAGGAGTAGGCAACTGG + Intronic
1070553705 10:77512250-77512272 CTAATTAGGGAAAAGGAGTCAGG - Intronic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072295654 10:94007159-94007181 TGGATTAGGGAGAGGGAGAGAGG + Intronic
1072896044 10:99367804-99367826 CAGATAAGAGAGATGAAGACAGG + Intronic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1074525472 10:114259821-114259843 CACATTGGGGAGACGGACACAGG - Intronic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075341265 10:121648440-121648462 CAGACTAGGTAGTAGGAGGCAGG - Intergenic
1075426638 10:122346987-122347009 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079196317 11:18330673-18330695 CTAATTAGGGAAAAGGAGTCAGG - Intronic
1079230424 11:18644661-18644683 CAGCCTGGGGAGAAGGAGAGAGG - Intergenic
1079297573 11:19246881-19246903 CAGAAGAGGGAGAAAGAGAGAGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079818480 11:25094082-25094104 CAGATCAGGCAAAAGGAGAGAGG - Intergenic
1080141233 11:28922798-28922820 CAGATAAGGGGGAAGCAAACTGG - Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1084173139 11:67410143-67410165 CAGATGAGGGAGGAGGGGAAGGG - Intronic
1085013639 11:73158420-73158442 TAGGATGGGGAGAAGGAGACAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1089094124 11:115904340-115904362 CAGCTTAGGGAGAAGCTGATTGG - Intergenic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091242175 11:134060614-134060636 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1091716389 12:2779715-2779737 CAGGTTAGGGAGATGGACAATGG + Intergenic
1091797449 12:3305419-3305441 CAGAATAGGGAGCAGGGGAGGGG - Intergenic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1093256211 12:16871492-16871514 TAGATTAGGGAGCAGGTGATGGG + Intergenic
1093808298 12:23463536-23463558 AAGATTCAGGAGAAGGAGAGTGG - Intergenic
1094086621 12:26600370-26600392 AAGATTGGGGAGAAAGAGAAGGG - Intronic
1094577982 12:31705621-31705643 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1094627050 12:32134143-32134165 TAGATTAGGAACATGGAGACTGG + Intronic
1095139901 12:38648900-38648922 CAAATTAGGGGGAAGGATAAAGG - Intronic
1096011113 12:48216142-48216164 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1098222600 12:68285836-68285858 CAGATTTGGGAGAAAGAGGTGGG + Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1099872651 12:88368962-88368984 CAGCTTGGGGAGAAGGGGAGAGG - Intergenic
1099902209 12:88725178-88725200 CCTATTTGGGAGCAGGAGACTGG + Intergenic
1099989520 12:89708442-89708464 CGGATTCGGGAGAAGCTGACGGG - Intronic
1100247080 12:92769200-92769222 CAGATTTGGGAGGAGGGGAGGGG + Intronic
1100305484 12:93346345-93346367 CAGATTTGTGAGCAGGAGAATGG + Intergenic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102646090 12:114404990-114405012 GAGATCAGAGAGCAGGAGACAGG - Intronic
1103480584 12:121247684-121247706 CAGCTTTGGGAGGAGGAGAGAGG + Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1105040940 12:132960709-132960731 CTAATTAGGGAAAAAGAGACAGG + Intergenic
1105806625 13:23955265-23955287 CAGAGTAGGAAGAAAAAGACAGG + Intergenic
1106679978 13:31999494-31999516 GAGACTGGGGAGAGGGAGACTGG - Intergenic
1107196375 13:37657184-37657206 CAGATTATTGTGAAGGAGAAAGG + Intronic
1109717006 13:66231321-66231343 CTGATAAGGGTGAAGGAGAAGGG + Intergenic
1112700192 13:101999066-101999088 AAGACTAGGGAGAGGCAGACTGG + Intronic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113108816 13:106799866-106799888 CAGATAAGAGAAAAGGAGAGTGG + Intergenic
1113423321 13:110186724-110186746 CAGCTTAGGGAGAAGAATGCTGG - Intronic
1113448595 13:110389360-110389382 CAGATTAGGGAGAAGGGTGATGG - Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1114356248 14:21912380-21912402 CTGATTAGGGAAAAGGAGTCAGG + Intergenic
1114492298 14:23110871-23110893 GAAATTAGGGATAAGGAGAGAGG + Intergenic
1114575460 14:23708724-23708746 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1115290513 14:31766925-31766947 AAGAGTAGGGAGAAGTAGATGGG + Intronic
1116552377 14:46257845-46257867 CAGATTTGGGAGGAGGAGAAAGG + Intergenic
1116689134 14:48082125-48082147 CAGATTAGGGAGTAAGAGACAGG - Intergenic
1117151082 14:52888977-52888999 GACAGAAGGGAGAAGGAGACGGG + Intronic
1117582176 14:57162612-57162634 GAGTTTAGGTAGGAGGAGACAGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121102188 14:91257507-91257529 TAGAGTAGGGGGATGGAGACTGG - Intergenic
1122851106 14:104531698-104531720 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1123833059 15:24161562-24161584 CATATCAGGGAGATGGAGACTGG + Intergenic
1123839782 15:24236625-24236647 CATATCAGGGAGATGGAGACTGG + Intergenic
1123852845 15:24378323-24378345 CATATCAGGGAGATGGAGACTGG + Intergenic
1123868698 15:24549740-24549762 CATATCAGGGAGATGGAGACTGG + Intergenic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125696288 15:41640128-41640150 GAGATTAGGGAGAATGATGCTGG + Intronic
1125784847 15:42307157-42307179 CAGAATAGGGAGGAGGAAAGAGG - Intronic
1126398269 15:48242463-48242485 CAAATTAGAGACAATGAGACAGG - Intronic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126909669 15:53404377-53404399 CAGAGTACAGAGAAGAAGACTGG - Intergenic
1126953497 15:53909419-53909441 CATTTTAGGGATGAGGAGACAGG + Intergenic
1127222166 15:56891292-56891314 CAGAAGAGGGAAAAAGAGACTGG - Intronic
1128315539 15:66657149-66657171 CACATTAGGAAGAAGGACAGTGG - Intronic
1129276832 15:74451109-74451131 GAGATACGGGAGAAAGAGACAGG - Intronic
1129482839 15:75842051-75842073 TAGATTAGGAAGAAAGAGACAGG + Intergenic
1129926147 15:79365964-79365986 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1134049071 16:11124325-11124347 CATTTTACGGAGAAGGAAACAGG + Intronic
1134567579 16:15264659-15264681 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134734909 16:16492011-16492033 GAGAGAAGGAAGAAGGAGACAGG + Intergenic
1134932613 16:18220208-18220230 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1136033295 16:27519153-27519175 CTGATAAGGCAGAAGAAGACAGG + Intronic
1136536293 16:30901877-30901899 CAGTTTAGGGAGGAAGAAACAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137941182 16:52687134-52687156 CACATTAGAGAGAAAGAGAGAGG - Intergenic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138747854 16:59384484-59384506 CAGTTTGGGGACAAGGAGAAAGG + Intergenic
1139563531 16:67758594-67758616 CACATTAGGGTGAAGCAGAGCGG - Intronic
1140400322 16:74666069-74666091 AAGAGGAGGGAGAGGGAGACGGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142287565 16:89177609-89177631 GAGATGAGGGAGGAGGAAACAGG - Intronic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1145773159 17:27508046-27508068 CAGGTTGGGGAGCAGGAGACTGG - Intronic
1145827824 17:27890620-27890642 TAGATTAGGGAAAAGGACAGTGG - Intronic
1145978231 17:28996540-28996562 AAGATTGGGGAGGAAGAGACTGG + Intronic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147540077 17:41350046-41350068 CAGATGAGGGAGAAAGAAAATGG + Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148844978 17:50524546-50524568 CAGATTAGGAAGAAGGGGCAGGG - Intronic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150445404 17:65224343-65224365 CAGGCTGGGGAGAAGGAAACAGG - Intronic
1150479640 17:65499396-65499418 CGGGTTAGGGAGCAGGAGGCTGG - Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150927415 17:69547596-69547618 CAGATTAGGAAGATGGACATAGG + Intergenic
1151164526 17:72192415-72192437 CAGATTTGGGAGAAGAAGATTGG + Intergenic
1152042941 17:77916786-77916808 CAGATTAGAGGGAGGGAGACAGG + Intergenic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153925411 18:9831434-9831456 CTAATTAGGGAAAAGGAGTCAGG - Intronic
1155045209 18:22097260-22097282 CAGAGTAGGGAGGAGGATACTGG + Intronic
1155525645 18:26713769-26713791 AAGAATAGGGACCAGGAGACAGG + Intergenic
1155581505 18:27313296-27313318 CAGATTTGGGATAGGGAGATGGG + Intergenic
1157357643 18:46950071-46950093 TAGATTAGGGAGAATGTGGCTGG - Intronic
1158145915 18:54312099-54312121 AATATAAGGGAGAAGGAGAGAGG - Intronic
1159532313 18:69670335-69670357 CAGTTGAGAGAGAAAGAGACAGG - Intronic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1163081276 19:14944495-14944517 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164592447 19:29514007-29514029 GAGATGAGGGGGAAGGAGAGGGG + Intergenic
1164809403 19:31144193-31144215 AAGATCGTGGAGAAGGAGACAGG + Intergenic
1165451761 19:35887993-35888015 CAGATTAGGGAGGGAGTGACCGG + Intronic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166954127 19:46451102-46451124 GAGGTTGGGGAGAAGCAGACGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167157882 19:47750417-47750439 CAGATTAGAGGGAGGGAGTCTGG + Intronic
1167465866 19:49650977-49650999 AAGATGAGGGAGAAGGGGAAGGG - Exonic
1167558035 19:50207630-50207652 CATTTTATGGAGAAGGAGTCAGG + Intronic
1167899456 19:52607980-52608002 CTAATTAGGGAAAAGGAGTCTGG + Intronic
925738689 2:6986288-6986310 CAGAGTAGGGAGGAGGAAATCGG - Intronic
925879260 2:8337861-8337883 CAGAATGGGGAGAAGGTAACAGG + Intergenic
926276981 2:11411447-11411469 CAGAATAGTGAGAAGGAAAAGGG - Intergenic
927352485 2:22133697-22133719 AAGAATAGGAGGAAGGAGACTGG - Intergenic
927621657 2:24667270-24667292 CAATTTAGGGAGTAGGAGCCAGG - Intronic
928115975 2:28545472-28545494 CAGGTTAGGGCGAAGGGCACTGG + Intronic
928168539 2:28988461-28988483 CAGCTGAGGGAGAAGGGCACAGG - Intronic
928407453 2:31025387-31025409 CATATTATGGAGAGAGAGACGGG + Intronic
929714760 2:44298694-44298716 AAGATTAGAGAGATGAAGACTGG - Intronic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931643631 2:64402875-64402897 CATATTAGGGAGGAGGAAATGGG - Intergenic
932147247 2:69333131-69333153 CACAGTAGGAAGAAGTAGACTGG - Intronic
932224514 2:70029068-70029090 CAGAGTAGGGGGTAGGGGACTGG + Intergenic
932273931 2:70436985-70437007 CAGATTATCAAGAAGGAAACAGG + Intergenic
932594690 2:73086717-73086739 AAGATTGGGAAGAAGGGGACAGG - Intronic
935588928 2:104827279-104827301 CGAAATAGGGAGAAGGGGACCGG + Intergenic
936032027 2:109080102-109080124 CAGAGGAGGGAAAAGGAGATGGG + Intergenic
936852474 2:116917432-116917454 CAGATGAGGAAGCAGGAGAGAGG + Intergenic
937219604 2:120334674-120334696 GAGCTTAAGGAGAAGCAGACTGG - Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937900088 2:127013303-127013325 TAGATAAGAGAGAAAGAGACAGG + Intergenic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938241474 2:129745345-129745367 CAGGTGAGGGAGAAAGAGAATGG + Intergenic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939995821 2:148918554-148918576 AAGAGTAGTGATAAGGAGACAGG + Intronic
940092069 2:149931769-149931791 TAGATTAGGGAGAAATAGCCTGG - Intergenic
940682778 2:156807205-156807227 CAGTGTAGGGAGAAGATGACTGG - Intergenic
940754246 2:157663518-157663540 CAGACTACGGGGAAGGAGACTGG + Intergenic
941588671 2:167390968-167390990 TAGATAAGGGAGAATAAGACAGG + Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
941801616 2:169665885-169665907 CTAATTAGGGAAAAGGAGTCAGG - Intronic
941911817 2:170771210-170771232 CGGGCTAGGGAGAGGGAGACCGG - Intergenic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
944356543 2:198796018-198796040 CAGATTAGGAACAAGGAATCAGG - Intergenic
946021649 2:216644276-216644298 AAGATTGGGGAGAAGGGGGCAGG + Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946375915 2:219308958-219308980 CAGGTTCGGGAGAAGGACACGGG - Intronic
946976915 2:225163533-225163555 GAGATTTGGGAGAAGGAAGCGGG - Intergenic
947308717 2:228776780-228776802 CAGGTCAGGGAGAAGGGCACTGG + Intergenic
947831028 2:233141819-233141841 GAGACTGGGGAGAAGGGGACTGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1170564843 20:17593091-17593113 AGGATAAGGGAGAAGGAAACTGG - Intronic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1172161473 20:32871783-32871805 CAGAACAGGAAGAAGGACACTGG - Intronic
1172324462 20:34023765-34023787 CTGATTGGGAATAAGGAGACTGG - Intronic
1172324509 20:34024046-34024068 CTGATTGGGAATAAGGAGACTGG + Intronic
1172572928 20:35984441-35984463 CAGATTAAGAAGAAGGGGAGTGG + Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172740320 20:37161418-37161440 AAGATGGGGGAGAGGGAGACGGG + Intronic
1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG + Intronic
1173338213 20:42130453-42130475 GAGATTGGAGAGAAGGAGAAAGG - Intronic
1173339300 20:42139385-42139407 CAGTTTATGTAGGAGGAGACAGG + Intronic
1174181703 20:48679251-48679273 CATTTAATGGAGAAGGAGACTGG + Intronic
1174543857 20:51310300-51310322 CTCATTAGGGAGGAGGAGTCAGG + Intergenic
1175259373 20:57664922-57664944 CAGATTAGGGAAACTGAGGCAGG - Intronic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1176365159 21:6028296-6028318 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177613059 21:23478590-23478612 CTGATTAGGTAGAAGTAGGCTGG + Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1179659075 21:42863169-42863191 CAGATTTGGGAGCAGGGGAGTGG - Intronic
1179758359 21:43510249-43510271 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1181955651 22:26586201-26586223 CAGCCTAGGGACATGGAGACGGG - Intronic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182324713 22:29503894-29503916 CAGATTAGGGGGAAAGGGACTGG - Intergenic
1183341753 22:37285324-37285346 GAGATAAGTGAGAAGGAAACGGG + Intronic
1183536585 22:38405154-38405176 AGGATTAGGGAGAATGAGATGGG - Intergenic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1185210285 22:49566851-49566873 CAGTTTACCGATAAGGAGACGGG - Intronic
949379970 3:3433557-3433579 CAGAAGAGGGAGAAGAAGAGAGG + Intergenic
949461217 3:4296956-4296978 CAGATGAGTGATAAGGAGAGAGG - Intronic
949815059 3:8049397-8049419 GAGACTAGGGAGAGAGAGACAGG - Intergenic
949928851 3:9062357-9062379 CAACATAGGGAGAAGGAGAGAGG - Intronic
950222776 3:11208988-11209010 CAGTTGAGGGTGAAGGAAACTGG - Intronic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950897500 3:16466974-16466996 CAGATGTGGGAGAAAGAGACTGG + Intronic
951537907 3:23756347-23756369 CAGATGAGGGTCAGGGAGACTGG - Intergenic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953278317 3:41526436-41526458 CACATTAGGCAGAACTAGACAGG - Intronic
953642730 3:44724823-44724845 TAAATTAGGGAGTAGGGGACTGG - Intergenic
953857291 3:46509208-46509230 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
954510761 3:51122843-51122865 TAGATTAGGGAGAACGATGCTGG + Intronic
954802055 3:53192992-53193014 CAGATGAGGGAGGAGGACAAGGG + Intergenic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955887765 3:63618913-63618935 CAAAGTGGGGAGAATGAGACAGG + Intergenic
956029276 3:65019703-65019725 CAGATGGGTGAGAAGGGGACAGG + Intergenic
956128923 3:66037152-66037174 CAAATTAGAGATAAGGAAACTGG - Intronic
956247949 3:67205117-67205139 CTTATTAGGGAAAAGGAGTCAGG + Intergenic
956381087 3:68665274-68665296 AAGATTAGGGGGAAGGGAACGGG + Intergenic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
957890212 3:86347075-86347097 CAGATTAGGAAAAAAGAGACAGG - Intergenic
958071240 3:88615842-88615864 CATATTAGGGAACATGAGACAGG + Intergenic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
959054898 3:101557779-101557801 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
959903467 3:111685084-111685106 CAGAATTGGGAGAAGGGCACAGG + Intronic
959936259 3:112032367-112032389 CTAATTAGGGAAAAGGAGTCGGG + Intergenic
961266438 3:125646930-125646952 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
962012337 3:131404042-131404064 CAGATGTGGGAGAACTAGACAGG + Intergenic
964812857 3:160684305-160684327 TAGAATGGGTAGAAGGAGACAGG - Intergenic
966662923 3:182434615-182434637 CAGAGTAGGGACTAGGAGCCAGG - Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
970517935 4:16851950-16851972 CAGAGTAGGCAGAAGAACACTGG - Intronic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
972744491 4:41920385-41920407 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
973012847 4:45098023-45098045 CAGATGAGGTAGAAAGAGAAAGG + Intergenic
974012448 4:56619049-56619071 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974379489 4:61120172-61120194 CACATTAGGGAGAAGGCCATGGG + Intergenic
974881038 4:67757455-67757477 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
979121063 4:116902267-116902289 GAGATAAGAGAGAAGGAGAGAGG + Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
980611964 4:135171984-135172006 CAGCTAAGGGTGAAGGAGAAGGG + Intergenic
981083241 4:140656307-140656329 CTAATTAGGGAAAAGGAGTCGGG + Intronic
982303625 4:153905873-153905895 GGGATTAGGGAGATGGAGCCTGG - Intergenic
982345837 4:154357325-154357347 CTAATTAGGGAAAAGGAGCCAGG + Intronic
983460901 4:168024921-168024943 CAAATTAGGGAAAAGGAGTCAGG + Intergenic
983976182 4:173936995-173937017 TAGATTAGGGGGAGGGAGAGTGG - Intergenic
984602646 4:181746054-181746076 CAGATAAGGGAGAGGGTGAGAGG + Intergenic
985056200 4:186037636-186037658 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
985268931 4:188176360-188176382 GAGATTAGAGAGAAAGAGAAGGG + Intergenic
985425827 4:189829074-189829096 CAGGTAAGGGAGAGAGAGACAGG - Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
986593089 5:9391640-9391662 CAGATGGGAGAGAAGGGGACAGG - Intronic
987045322 5:14102313-14102335 CAAATTGGGGTGAAGGAGAGTGG - Intergenic
989157155 5:38355107-38355129 GAGAGTGGGGAGAATGAGACAGG + Intronic
991257845 5:64634681-64634703 CTCATTAGGTAGAAGGACACTGG + Intergenic
991368541 5:65894438-65894460 CTGAATGGGGAAAAGGAGACAGG - Intergenic
993839467 5:92859232-92859254 GAAATTAGGCAGAAGGACACAGG - Intergenic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
996445443 5:123543929-123543951 CTAATTAGGGAAAAGGAGTCAGG + Intronic
997817991 5:137036414-137036436 GAGCTTAGGGAGGAGGACACAGG - Intronic
998608686 5:143664138-143664160 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
998876470 5:146605295-146605317 CATATTACAGAGAAGGAAACAGG - Intronic
999212847 5:149905282-149905304 CCACTTAGGGAGAGGGAGACAGG - Intronic
999456495 5:151720736-151720758 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1000402603 5:160847077-160847099 CAGTTTATAGATAAGGAGACTGG + Intronic
1000945396 5:167417066-167417088 AAGATTAGGGACATGGAGAAGGG - Intronic
1001420819 5:171585957-171585979 CAGATTTGGGGGAGGCAGACAGG + Intergenic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002675638 5:180910200-180910222 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1002816311 6:684174-684196 GAGGTTAGGGAGGGGGAGACAGG + Intronic
1003066736 6:2910035-2910057 CAGATTTGGGCGCAGGAGAATGG + Intergenic
1003273229 6:4625367-4625389 CAGACTTGGGAGGAGGAGAACGG + Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1003423069 6:5975295-5975317 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005936925 6:30530152-30530174 CAGGTTAGGGAGGATGAGAGGGG + Intergenic
1006878430 6:37318325-37318347 CAGTTTATGGAGAAGGCTACAGG + Intronic
1007181293 6:39931196-39931218 CAGATTAGGGTGAAGGGGGTGGG + Intronic
1009589760 6:65652400-65652422 GAGGATAGGGAGGAGGAGACAGG + Intronic
1009844933 6:69122451-69122473 AAGATAAGGGAGAGGGAGAGGGG + Intronic
1010874090 6:81079823-81079845 CAGATTAGAGAGACGGAAAGTGG + Intergenic
1012488485 6:99749748-99749770 CAGTTTGGTGAGAAGGCGACTGG + Intergenic
1012599698 6:101079867-101079889 CAGATGAGGGTGAAGGAGAGTGG - Intergenic
1013076917 6:106780003-106780025 CACAGTATGGAGAAGAAGACAGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1015314527 6:131803635-131803657 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1015317458 6:131832470-131832492 AAGATCTGGGAGAAGGAGAAAGG + Intronic
1015552719 6:134428792-134428814 CAGGTTGTGGAGAAGGAGACTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017027874 6:150197485-150197507 GAGATTAGTGAGAAGGGAACAGG + Intronic
1018124757 6:160670892-160670914 CAGCTAAGGGAGAGGCAGACAGG - Intergenic
1018192217 6:161319593-161319615 AAAGTTAGGGGGAAGGAGACTGG + Intergenic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1019593999 7:1850103-1850125 CAGATTAAGGCGAACGAGAGTGG - Intronic
1019795320 7:3044074-3044096 CAGATCAGGGAGCCGGAGATGGG + Intergenic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021907371 7:25348684-25348706 CAGAGTTGGGGGCAGGAGACTGG + Intergenic
1023808384 7:43891379-43891401 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1025020012 7:55473283-55473305 CACATTAGGGTGGAGGAAACTGG + Intronic
1027233234 7:76283642-76283664 CAGGTTAGTGAGAAAGAGAGAGG - Intronic
1028553598 7:92099115-92099137 CAGATAAGGGTGAAGGAAAGTGG - Intronic
1028653961 7:93181259-93181281 CAGTTTAGGGGAAAGGAGAAAGG + Intergenic
1029263671 7:99322246-99322268 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1029687457 7:102158514-102158536 CAGGTTAGTCACAAGGAGACCGG - Intronic
1030147167 7:106368353-106368375 AAAATTAGGGAGAGGCAGACAGG - Intergenic
1030803634 7:113886571-113886593 CAAATTAGGGAGAAGGAATCAGG + Intronic
1030829119 7:114198785-114198807 AAGAGTGGGGAGAAGGAGAGAGG + Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032283007 7:130520689-130520711 CATATTATGGAGAAGATGACAGG - Intronic
1032536265 7:132667152-132667174 GAGCCTGGGGAGAAGGAGACAGG + Intronic
1032594955 7:133230215-133230237 GAAAATTGGGAGAAGGAGACAGG + Intergenic
1033002885 7:137526388-137526410 CGGCTTAGTGAGAAGGCGACAGG - Intronic
1033080212 7:138289534-138289556 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1033414040 7:141146812-141146834 CGGCTTAGGGAGCAGGAGAAGGG - Intronic
1034476434 7:151286789-151286811 AAAATTAGAGAGATGGAGACCGG + Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1036522056 8:9501029-9501051 CTAATTAGGGAAAAGGAGTCAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037645159 8:20786566-20786588 CAGACTAGGGGGAAGATGACTGG + Intergenic
1038133066 8:24755458-24755480 CAGATTCATGAGTAGGAGACTGG + Intergenic
1038687173 8:29729158-29729180 CATATTAGAGAAAAGGAGAATGG + Intergenic
1039559770 8:38503779-38503801 CGGAGTGGGAAGAAGGAGACTGG - Intergenic
1040781463 8:51114774-51114796 GAGAGAAGGGAGAAGGAGAGAGG - Intergenic
1042257554 8:66821090-66821112 CAGATTGGGGAGAGGGTGCCGGG + Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1043476483 8:80610692-80610714 CAGATTATGGAGAAGAGAACTGG + Intergenic
1043615997 8:82126401-82126423 AGGAGTAGGGAGAATGAGACAGG + Intergenic
1045476214 8:102555132-102555154 CAGAAGAGGGAGGAAGAGACAGG - Intronic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045578385 8:103450704-103450726 AAGGTTAGGGAGAAGGAACCAGG - Intergenic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046058545 8:109108259-109108281 CAAATGATGGAGAAGGAGAGAGG - Intronic
1046481776 8:114829245-114829267 CAAATGAGGGAGAAGGAGTAGGG + Intergenic
1046844903 8:118904583-118904605 CAGTTTATGGACAAGGAAACAGG - Intergenic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1048393472 8:133989941-133989963 TATTTTAGGGAGAAGGAAACAGG - Intergenic
1050013796 9:1211723-1211745 CAGGTTAAGGACATGGAGACTGG - Intergenic
1050106355 9:2170342-2170364 CAGCCTAGGAAGAAGGAGCCGGG + Intronic
1050377376 9:4986538-4986560 CTGAGTATGGAGAAGGAAACTGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051240985 9:15055486-15055508 CAGAAGAGGGAGAAAGAGAAAGG + Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1053057761 9:35004254-35004276 CAGCTAAGGGTGAAGGAGAAGGG - Intergenic
1053242519 9:36507607-36507629 CAGCTTAGGTGCAAGGAGACAGG - Intergenic
1055484222 9:76741430-76741452 CTAATTAGGGAAAAGGAGTCAGG + Intronic
1055580743 9:77703877-77703899 GAGACGAGGGAGAGGGAGACGGG + Intergenic
1055738878 9:79363962-79363984 AAGAGTAGGAAGAAGGAAACTGG - Intergenic
1055913824 9:81379954-81379976 CAGATTAGGGAGAAGGGAAAGGG + Intergenic
1056507415 9:87270390-87270412 CAGAGTAGAGTGGAGGAGACGGG - Intergenic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1059142980 9:111871420-111871442 CTAACTAGGGAGAAGGAGTCAGG + Intergenic
1059151880 9:111956415-111956437 GAGATCAGGGAGAAGGAGAGAGG - Intergenic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061858519 9:133456046-133456068 CTGAAAAGGGAGCAGGAGACAGG - Intronic
1062121723 9:134837406-134837428 CAGATTAGGGAGCAGGGGTCTGG - Intronic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1185751187 X:2610610-2610632 GAGACAAGAGAGAAGGAGACAGG - Intergenic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187745825 X:22408283-22408305 CATATGAGGGACAAGAAGACGGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188417829 X:29957909-29957931 CAGATTATAGAGAAGGACACAGG - Intergenic
1188894021 X:35644079-35644101 TATGTTTGGGAGAAGGAGACAGG + Intergenic
1189322142 X:40093403-40093425 AAGAGGAGGGAGGAGGAGACTGG + Intronic
1190938706 X:55019734-55019756 CAGACTAGAGAGTAGGAGACTGG + Intronic
1192706041 X:73529285-73529307 CAGCTTAGGGAGGAGGGGAGAGG - Intergenic
1194044962 X:88991357-88991379 CTAATTAGGGAAAAGGAGTCAGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197787581 X:130214423-130214445 CAGATGCGGGAGACAGAGACAGG + Intronic
1198206291 X:134468267-134468289 CATATTAGTGATAAGGATACAGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic