ID: 1013438722

View in Genome Browser
Species Human (GRCh38)
Location 6:110139422-110139444
Sequence TTGCAGCAGCTGCTACATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013438714_1013438722 6 Left 1013438714 6:110139393-110139415 CCGCTCCTCCCCCGTTGCAGCCA 0: 1
1: 0
2: 6
3: 57
4: 389
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438715_1013438722 1 Left 1013438715 6:110139398-110139420 CCTCCCCCGTTGCAGCCAGCATC 0: 1
1: 1
2: 28
3: 74
4: 295
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438712_1013438722 12 Left 1013438712 6:110139387-110139409 CCCTGACCGCTCCTCCCCCGTTG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438711_1013438722 16 Left 1013438711 6:110139383-110139405 CCAGCCCTGACCGCTCCTCCCCC 0: 1
1: 0
2: 8
3: 87
4: 947
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438718_1013438722 -4 Left 1013438718 6:110139403-110139425 CCCGTTGCAGCCAGCATCTTTGC 0: 1
1: 6
2: 19
3: 53
4: 251
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438713_1013438722 11 Left 1013438713 6:110139388-110139410 CCTGACCGCTCCTCCCCCGTTGC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438708_1013438722 26 Left 1013438708 6:110139373-110139395 CCACCTGTTCCCAGCCCTGACCG 0: 1
1: 0
2: 4
3: 50
4: 394
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438716_1013438722 -2 Left 1013438716 6:110139401-110139423 CCCCCGTTGCAGCCAGCATCTTT 0: 1
1: 1
2: 8
3: 42
4: 173
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438717_1013438722 -3 Left 1013438717 6:110139402-110139424 CCCCGTTGCAGCCAGCATCTTTG 0: 1
1: 2
2: 9
3: 32
4: 192
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438710_1013438722 17 Left 1013438710 6:110139382-110139404 CCCAGCCCTGACCGCTCCTCCCC 0: 1
1: 0
2: 6
3: 68
4: 664
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438709_1013438722 23 Left 1013438709 6:110139376-110139398 CCTGTTCCCAGCCCTGACCGCTC 0: 1
1: 0
2: 1
3: 43
4: 292
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438707_1013438722 27 Left 1013438707 6:110139372-110139394 CCCACCTGTTCCCAGCCCTGACC 0: 1
1: 0
2: 8
3: 67
4: 630
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data
1013438719_1013438722 -5 Left 1013438719 6:110139404-110139426 CCGTTGCAGCCAGCATCTTTGCA 0: 1
1: 3
2: 13
3: 67
4: 306
Right 1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013438722 Original CRISPR TTGCAGCAGCTGCTACATAC GGG Intronic
No off target data available for this crispr