ID: 1013440715

View in Genome Browser
Species Human (GRCh38)
Location 6:110164469-110164491
Sequence TCATGCATCATGTGTCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013440715 Original CRISPR TCATGCATCATGTGTCAGTA GGG Intronic
903761041 1:25698986-25699008 TCATGCTTCCAGTCTCAGTATGG - Intronic
908162075 1:61420085-61420107 TATTGGATCATGTGTAAGTAAGG + Intronic
909610248 1:77543951-77543973 TCATGCATCATTTAACAGTAAGG + Intronic
910178445 1:84455958-84455980 TGAAACATCATGTATCAGTATGG + Intergenic
912922682 1:113884646-113884668 TCTTGAATCATTTGACAGTAAGG - Intronic
913088614 1:115460847-115460869 TCAAGCCTCATGTGGCAGTCAGG + Intergenic
917735874 1:177919903-177919925 TCATGATTTGTGTGTCAGTAGGG - Intergenic
1067121503 10:43475799-43475821 TCCAGCATCATGTCTCTGTACGG - Exonic
1070263766 10:74882733-74882755 TCTTCCCTAATGTGTCAGTAAGG + Intronic
1071058187 10:81535517-81535539 TCATATATCATGTGTCAACAAGG - Intergenic
1075593447 10:123709451-123709473 TAATGCATCCTGTATCAGTCAGG + Intronic
1087177172 11:95106604-95106626 TCATGTAACATGTGTAAGCAAGG - Intronic
1088466862 11:110148996-110149018 TCCTTCATCATGCGTCAGTAAGG + Intronic
1091626539 12:2125105-2125127 TCATACACCACGTGTCAGGAAGG + Intronic
1098094691 12:66942586-66942608 TCATGCAGCATGGGTTAGTTGGG + Intergenic
1099566348 12:84252659-84252681 TAATGCATCATGTGTCAGGAGGG + Intergenic
1101435565 12:104661189-104661211 TCTTGCCTCATTTGTCAGTGGGG + Intronic
1106065580 13:26345165-26345187 TCATGCAGCATGTGACTGTACGG + Intronic
1107089437 13:36460657-36460679 TCATGCATCACTTAACAGTAAGG - Intergenic
1108082665 13:46753244-46753266 TAATGCATCATGTGACAACAGGG + Intergenic
1108985605 13:56583116-56583138 TGATGTATCATGTGGCAATATGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109107194 13:58268245-58268267 TCATTCAGCATGATTCAGTATGG - Intergenic
1111065270 13:83083004-83083026 GCATACTTCATGTCTCAGTATGG - Intergenic
1113292429 13:108921398-108921420 TTATGTATCATGTGTAAGAATGG - Intronic
1113723063 13:112575216-112575238 TCTTTCATCATGTCTCAGTTGGG - Intronic
1114101763 14:19387316-19387338 TCAGGCATCATATGTCACTGCGG - Intergenic
1115186414 14:30693217-30693239 TCATACTTCTTGTGTCAGAAAGG + Intronic
1116809455 14:49525151-49525173 TCCTGCCTCATATGTTAGTATGG - Intergenic
1116875386 14:50106517-50106539 TCATGCATCATTTCTCAGGCTGG + Intergenic
1117149450 14:52870789-52870811 TCATGTATCATTTAACAGTAGGG - Intronic
1121041837 14:90756059-90756081 CAAGGCATCATGTGTTAGTAAGG - Intronic
1123966261 15:25462196-25462218 TCATGCATCATGTAACAATGGGG - Intergenic
1133358073 16:5151602-5151624 GCATGCTGCATGTGTCAGGATGG - Intergenic
1140630047 16:76840853-76840875 TCATCTTTCATGTGTCAGAATGG - Intergenic
1146437052 17:32859900-32859922 TCCTGCAGCATGTGGCTGTATGG - Intronic
1150934857 17:69624120-69624142 TGAAGCATCAGGTGTCTGTAGGG + Intergenic
1151240987 17:72757700-72757722 TCATGCGTCATTTCTCAGTCTGG + Intronic
1152281864 17:79389609-79389631 TCATGTGTCATGTGTCGGTAAGG - Intronic
1163231109 19:16002938-16002960 TCTTGCATCCTATGTCAGTTGGG + Intergenic
1168134719 19:54342612-54342634 TAATGCGTCAGCTGTCAGTATGG + Intergenic
1168547153 19:57262800-57262822 TCTAGCATCATGTCTCTGTAAGG - Intergenic
925552366 2:5090287-5090309 TCATGCATCAGTTTTCAATATGG - Intergenic
926888637 2:17620170-17620192 TCATGCCTAATGTGTCCGTCAGG + Intronic
928241953 2:29594262-29594284 ACATGCATATTGTGTCTGTATGG + Intronic
930277144 2:49324950-49324972 TCATGCCTCATTTGACAATAGGG - Intergenic
931408851 2:62008696-62008718 TCAACTATCATTTGTCAGTAGGG + Intronic
932744556 2:74322256-74322278 TCATCCATTATGTGTCAGTTAGG - Intronic
933081081 2:77987508-77987530 TCTCACATCATGTGTCATTAGGG + Intergenic
934584150 2:95474942-95474964 GCAGGCATCATGGTTCAGTACGG + Intergenic
934595302 2:95601772-95601794 GCAGGCATCATGGTTCAGTACGG - Intergenic
934787470 2:97023762-97023784 GCAGGCATCATGGTTCAGTAAGG + Intergenic
938719196 2:134050720-134050742 TCACACATCATGTGTCATCAGGG + Intergenic
939549899 2:143602333-143602355 TCATGGTTCTTGGGTCAGTAAGG + Intronic
941282206 2:163566736-163566758 TCATTAATCAAGTGTCTGTATGG - Intergenic
941855476 2:170226595-170226617 TCATGTGTCATATGTCAGTGTGG + Intronic
946756426 2:222952280-222952302 TAAAGCATCATGGGTCAGCAAGG - Intergenic
946822223 2:223642083-223642105 TCACGTATCATGTATCAGCATGG - Intergenic
948240774 2:236431694-236431716 TGTTGCATAATGTTTCAGTATGG + Intronic
1170168607 20:13386327-13386349 TCATGCATAAAGAGTCTGTAGGG + Intergenic
1171526496 20:25816330-25816352 TCATGCAGCTTGTGTATGTAAGG + Intronic
1171550331 20:26039555-26039577 TCATGCAGCTTGTGTATGTAAGG - Intergenic
1172129229 20:32644830-32644852 TCATGCATCGTGTACCTGTATGG + Intergenic
1180478973 22:15735274-15735296 TCAGGCATCATATGTCACTGTGG + Intergenic
953270065 3:41433291-41433313 TCAGGTTTCATGTGTCAGAATGG + Intronic
956285838 3:67609061-67609083 TCATGCAGCATGGGTCAGGCAGG + Intronic
957062593 3:75494197-75494219 GCATGCTGCATGTGTCAGGATGG - Intergenic
957224955 3:77431536-77431558 TCAGGCATAATGTGCAAGTAGGG - Intronic
959150836 3:102605647-102605669 TCATGCACATTGAGTCAGTAAGG - Intergenic
961290806 3:125845219-125845241 GCATGCTGCATGTGTCAGGATGG + Intergenic
961842976 3:129733490-129733512 TCAGGTATAATTTGTCAGTAAGG + Intronic
962918128 3:139926757-139926779 TCATGAATCATGTGTCCAAAGGG - Intergenic
963413042 3:144956066-144956088 TCATGAATCTTGTATCAGTCAGG - Intergenic
965413147 3:168357363-168357385 TCATGTTTCATGTGTCTCTAAGG + Intergenic
969806472 4:9612982-9613004 GCATGCTGCATGTGTCAGGATGG + Intergenic
972109459 4:35539397-35539419 ATATGCATCATATGTCATTAGGG + Intergenic
972354381 4:38266828-38266850 TAATGCATGATGAGTCAGGACGG + Intergenic
972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG + Intronic
973229986 4:47829718-47829740 CCATGCATCTGGTGTCAGGAAGG + Intronic
973834523 4:54795962-54795984 TCATGCATGCTGTGACAGGAAGG - Intergenic
975341438 4:73245696-73245718 TCTTGGATGATGTATCAGTAAGG - Intronic
976747235 4:88415525-88415547 TGATACATCCTTTGTCAGTACGG - Intronic
977174578 4:93804586-93804608 TTATGCATCATGTGACTATATGG + Intergenic
985510461 5:310472-310494 TCTTGCCTCCTGAGTCAGTAAGG + Intronic
993523968 5:88941707-88941729 CCACCCATCATGTGACAGTATGG + Intergenic
999142674 5:149372702-149372724 TCTTGCATCAAGAGTCAGCATGG + Intronic
1003007723 6:2397370-2397392 TCATGCATCATGTGTCTCGTTGG - Intergenic
1003236682 6:4301285-4301307 TCAGGCCTCATGGGTCATTATGG + Intergenic
1005413787 6:25580056-25580078 TCATGAATGATGTGGCAGGAAGG + Intronic
1009733513 6:67642700-67642722 TTATGCATCTGGTTTCAGTATGG - Intergenic
1013440715 6:110164469-110164491 TCATGCATCATGTGTCAGTAGGG + Intronic
1014291005 6:119558798-119558820 TCATGCATCTTTTGTCAGCAGGG + Intergenic
1014462313 6:121711261-121711283 TCCAGCATCATTTGTTAGTAAGG - Intergenic
1021799772 7:24293399-24293421 TCATGCATCAATTATCAATAGGG - Intergenic
1025159529 7:56642604-56642626 TCATGAATAATGCTTCAGTATGG - Intergenic
1025299167 7:57803601-57803623 TCATGCAGCTTGTGTATGTAAGG - Intergenic
1025796931 7:64746581-64746603 TCATGCATGAATTGACAGTAGGG - Intergenic
1030735646 7:113044889-113044911 TCATGAATCATTTTTCAATAGGG + Intergenic
1032978428 7:137252707-137252729 TCAGGCATCATGTCCCACTATGG + Intronic
1041633838 8:60119738-60119760 GCATGCCTCATGTGTCTGTGTGG - Intergenic
1043946949 8:86264242-86264264 TCATGCATCATGTAACAACAAGG + Intronic
1045092514 8:98760932-98760954 TCATGCATAGTGTTTAAGTAAGG - Intronic
1050197430 9:3101459-3101481 CAATGCATTATGTGTCTGTATGG - Intergenic
1052801920 9:32976431-32976453 TAATTCATCATGTGTGAGTGAGG - Intronic
1053794417 9:41712430-41712452 TCATGCAGCTTGTGTATGTAAGG + Intergenic
1054150761 9:61602394-61602416 TCATGCAGCTTGTGTATGTAAGG - Intergenic
1054182820 9:61924474-61924496 TCATGCAGCTTGTGTATGTAAGG + Intergenic
1054655685 9:67664001-67664023 TCATGCAGCTTGTGTATGTAAGG - Intergenic
1056899712 9:90586434-90586456 TCTTGCATCCTGGATCAGTATGG - Intergenic
1057532303 9:95860618-95860640 TTATGAATCATTTGTCAGTGGGG + Intergenic
1061045491 9:128162839-128162861 TCATCCTTCAAGTCTCAGTATGG - Intronic
1062203948 9:135325223-135325245 TCATTCCTCATGTTTCACTATGG - Intergenic
1062260786 9:135662266-135662288 TCATGCATAATTTGACAGTGGGG + Intergenic
1185919616 X:4076360-4076382 TCAAGCCTCAAATGTCAGTATGG + Intergenic
1186843237 X:13506097-13506119 TCATGAGTCATGAGTCCGTATGG - Intergenic
1186965103 X:14778435-14778457 TGATGCATGATGTCTCAGTTGGG - Intergenic
1188297465 X:28467195-28467217 TCATGCATTAATTATCAGTATGG + Intergenic
1188575990 X:31650799-31650821 TCATGCATCAAGTCTCAGGAGGG + Intronic
1195450780 X:105010010-105010032 TCATTTATCTTGTGTCTGTAAGG + Intronic
1196730001 X:118931256-118931278 TAATACATCATGTGTAAGTGTGG - Intergenic
1197083034 X:122441228-122441250 TCCTGCATCCTGTGTCCATAGGG + Intergenic
1197286316 X:124599230-124599252 CCATGCATCATGTCTTAGTTTGG + Intronic
1198396880 X:136228381-136228403 CCATACATCATGTGCCATTAAGG - Intronic
1198841539 X:140862919-140862941 TCATGCAAAATGTGTCTGTTTGG + Intergenic
1200805247 Y:7427220-7427242 TCATGCAGTATGTGTCATTACGG - Intergenic