ID: 1013440969

View in Genome Browser
Species Human (GRCh38)
Location 6:110168557-110168579
Sequence ATTTGAAGTGGGAATCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013440969 Original CRISPR ATTTGAAGTGGGAATCTTGG AGG (reversed) Intronic
900837860 1:5019695-5019717 ATTTGACATGTGAATTTTGGGGG + Intergenic
901093095 1:6656272-6656294 ATTTTGTGTAGGAATCTTGGTGG + Intronic
901250721 1:7777284-7777306 AGTTGAAGAGGAAATATTGGTGG + Exonic
902776985 1:18681232-18681254 ATTTTAAGAGGGCACCTTGGGGG - Intronic
905099502 1:35506792-35506814 GTTGGAACTGGGCATCTTGGAGG - Exonic
905280388 1:36845506-36845528 GTTGGAAGAGGGAGTCTTGGGGG + Intronic
906006595 1:42478241-42478263 ATTGGAAGTGGGAAACTTAGGGG + Intronic
906146431 1:43563442-43563464 ATCTGAAGTTGGAATCTTACAGG + Intronic
907228333 1:52970565-52970587 ATCTGAGGTGGGAATCTTAAAGG - Intronic
909727519 1:78853312-78853334 ACTTTAGGTGGGGATCTTGGGGG + Intergenic
910518716 1:88093134-88093156 ACTTGAAGTGGATATCTAGGAGG + Intergenic
912777963 1:112518156-112518178 ATTTGTGGTGGGATTCTTGGAGG + Intronic
913135232 1:115882062-115882084 ATTTGAAGTGGATATCTTTTGGG - Intergenic
913943334 1:125129227-125129249 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
915141531 1:153771350-153771372 AGAGGAAGTGGGAAGCTTGGAGG + Intronic
916017948 1:160766940-160766962 CTTTGAAGTGGAGATCTTAGTGG - Intergenic
916616152 1:166442675-166442697 AGTTGAAGTGTGTTTCTTGGAGG + Intergenic
917871506 1:179246269-179246291 ATTTCAAGTGGGAGTCTTACAGG - Intergenic
917940758 1:179918872-179918894 ATATGAACTGTTAATCTTGGTGG + Exonic
920044557 1:203124975-203124997 CTTTGCATTGGGCATCTTGGAGG + Intronic
921266320 1:213423735-213423757 CTTTAAAGTGGGAGCCTTGGAGG + Intergenic
921526094 1:216220507-216220529 ATTTTAAGTAGAAGTCTTGGAGG + Intronic
922811002 1:228415532-228415554 AGTTGGAGTGGGGATCTGGGTGG - Exonic
922844448 1:228672522-228672544 ATTTGAAGTCGGAATTTAGGTGG + Intergenic
923281866 1:232450894-232450916 AGTTGAAGAGAGAATCTGGGTGG + Intronic
1063627697 10:7705903-7705925 ATTGGAAGTTGCAATCCTGGCGG + Intronic
1064695343 10:17959507-17959529 CTTTGAAGTGGAAGTTTTGGGGG - Intronic
1066953097 10:42139837-42139859 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1067514492 10:46926062-46926084 ATTTGAAGTCTGAGTCTTGAGGG + Intronic
1067647768 10:48125751-48125773 ATTTGAAGTCTGAGTCTTGAGGG - Intergenic
1069201300 10:65619826-65619848 ATTTGGACTGAGAATATTGGTGG + Intergenic
1070201404 10:74209120-74209142 ATAAGAAGTGTGACTCTTGGGGG + Intronic
1070323117 10:75369772-75369794 ATATGAAGTAGTTATCTTGGTGG + Intergenic
1070538962 10:77402412-77402434 ATTTAAAGTTGGAGTTTTGGAGG - Intronic
1071313425 10:84366553-84366575 ATTTTAACTGGAAATGTTGGTGG + Intronic
1071472912 10:85997815-85997837 ATTTGAAGTGAGTTTCTTGTAGG - Intronic
1073100180 10:101002370-101002392 ACTTGAAGGGGGAGTCTTGGTGG + Exonic
1073854204 10:107656172-107656194 ATTTGAAGGAGGAGGCTTGGAGG + Intergenic
1073875099 10:107914094-107914116 AAGTGAAGTGGGAATCCTTGAGG + Intergenic
1076801367 10:132831627-132831649 ATTTAAAGTGGGTTTCTTGGAGG + Intronic
1079410504 11:20183021-20183043 ATTTGATGTGGGTATCTTTTGGG + Intergenic
1081515922 11:43829554-43829576 ATTTCCAGTTGGAATATTGGGGG - Intronic
1083614314 11:64018839-64018861 CTTTGAGGTGGGCATGTTGGGGG - Intronic
1084379074 11:68799230-68799252 ATTTGAAGTTAAAATCCTGGTGG - Exonic
1084467255 11:69332727-69332749 ATTTAAAGTGGGCTTCTTGTAGG + Intronic
1085247376 11:75114152-75114174 AGTTGAAGTGGGTTTCTTGTAGG - Intronic
1086836042 11:91624314-91624336 ATTTGAACCAGGAAGCTTGGAGG - Intergenic
1086958560 11:92958810-92958832 ACTTGAAGTGGGAAACCTGGAGG + Intergenic
1087029227 11:93685626-93685648 AATTTAAGTGGAAAGCTTGGAGG - Intronic
1088760865 11:112927739-112927761 AATGCCAGTGGGAATCTTGGTGG + Intergenic
1090723730 11:129502045-129502067 ATTTGAAGTGGGTTTCCTGTAGG - Intergenic
1090966619 11:131603243-131603265 CTCTGAAGTGGGTATGTTGGAGG - Intronic
1091589217 12:1833552-1833574 ATCTGGAGGGGGAATCCTGGAGG - Intronic
1092636740 12:10459231-10459253 ATATTTAGTGGGAATGTTGGTGG - Intergenic
1093558497 12:20508261-20508283 ATTTGAAATGGGAGTCCTGCGGG - Intronic
1094256684 12:28438177-28438199 AGTTGCAGTAGGAATTTTGGAGG - Intronic
1094352776 12:29545098-29545120 ATTTGAGCTGGGAATCTTGCTGG - Intronic
1095301242 12:40586415-40586437 AGTCAAAGTGGGAATTTTGGAGG + Intergenic
1096824962 12:54268523-54268545 ATTTGAATTGGGAATGTAGTTGG - Intronic
1098737469 12:74125141-74125163 ATTTAAAGTGGGTTTCTTGTAGG - Intergenic
1099474766 12:83094805-83094827 ATTTAGATTAGGAATCTTGGAGG + Intronic
1101648400 12:106652782-106652804 CTTTCAAGTGGGCACCTTGGGGG + Intronic
1102527533 12:113522279-113522301 ATTTGGAACAGGAATCTTGGGGG + Intergenic
1104394097 12:128416935-128416957 ATTTGCATTGTGAACCTTGGTGG + Intronic
1105232428 13:18509753-18509775 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1105406289 13:20135118-20135140 ATTTGAAATGGGATTCTTATGGG + Intergenic
1105761081 13:23514984-23515006 GTTTGGAGTGGGAATATTGTGGG + Intergenic
1106193988 13:27477582-27477604 ATTTGAAGAGGAAGTCCTGGGGG - Intergenic
1106316148 13:28595797-28595819 AATTGAGGTGGGAAAGTTGGAGG + Intergenic
1106993927 13:35458424-35458446 TTTTTAAGTGGGAACCTTTGAGG - Intronic
1107153318 13:37137928-37137950 ATTAAAAGTGGTAATTTTGGGGG - Intergenic
1108284187 13:48889883-48889905 TTAGGAGGTGGGAATCTTGGAGG - Intergenic
1108559951 13:51633258-51633280 CTCTGAAGTGGGGATCCTGGTGG + Intronic
1108673284 13:52713245-52713267 ATTTGAAGTGAAAATCTTGTGGG + Intronic
1110931023 13:81216872-81216894 GTGTGATGTGGGAATCTTGGTGG + Intergenic
1112120752 13:96408284-96408306 CTTTGAAATAGGAATATTGGGGG - Intronic
1114899523 14:27039400-27039422 ATTTGAAGTAGGAAACTTGTGGG + Intergenic
1117030290 14:51661911-51661933 TTTGGAAATGGGAATGTTGGAGG + Intronic
1117363730 14:55004179-55004201 AAGTGGAGTGGGAATCTTTGAGG - Intronic
1118015280 14:61654168-61654190 ATTTGGGGTGGGGAGCTTGGTGG + Exonic
1120768252 14:88351471-88351493 ATTTAACGTGTGAATTTTGGAGG - Intergenic
1131650058 15:94388435-94388457 ATTTGGAGAGGGAATGTTGCAGG - Intronic
1132311750 15:100862403-100862425 GTGAGAAGTGGGGATCTTGGGGG + Intergenic
1136770621 16:32837141-32837163 ATTTTAAGTGGCAATGTTTGAGG - Intergenic
1136899994 16:34024943-34024965 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1137083188 16:36091756-36091778 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1137614136 16:49836991-49837013 CTTTGAATTGGGAATCTGAGTGG - Intronic
1138164953 16:54792588-54792610 ATATGAAGTCTAAATCTTGGTGG + Intergenic
1138857232 16:60708819-60708841 ATTTGAAATGTGCTTCTTGGGGG - Intergenic
1140978247 16:80081685-80081707 ATTAGAAGGGGGAATATTGTGGG + Intergenic
1141063704 16:80897625-80897647 ATTTCGAGTGGGAACTTTGGGGG - Intergenic
1141375877 16:83530140-83530162 ATTTGAAATGAGCATTTTGGGGG + Intronic
1141429545 16:83964579-83964601 ATTTGAGGTGACAATCATGGTGG + Intronic
1141644888 16:85362014-85362036 ATTTGAAGTGGCCGTCTGGGAGG + Intergenic
1203073042 16_KI270728v1_random:1099250-1099272 ATTTTAAGTGGCAATGTTTGAGG - Intergenic
1145691254 17:26742001-26742023 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1146121865 17:30202800-30202822 ATTTTAAGTGGCAATTATGGTGG - Intronic
1147256042 17:39182856-39182878 TATTGAACTTGGAATCTTGGGGG - Intronic
1147463269 17:40589542-40589564 AATCCAAGTGGGAATCATGGCGG - Intergenic
1149388345 17:56164670-56164692 TTTTCAACTTGGAATCTTGGGGG - Intronic
1150703341 17:67466588-67466610 CTTTGAAGTGGGACTCTTAGAGG - Intronic
1151514854 17:74586699-74586721 AATACCAGTGGGAATCTTGGTGG - Intronic
1153876120 18:9373001-9373023 ATTTAAAGTGGGTTTCTTGTAGG - Intronic
1154520888 18:15228940-15228962 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1158958831 18:62570239-62570261 CTTTGAAGTGGGAGTATTGTTGG + Intronic
1160465239 18:79070876-79070898 ATTTGAAGTGAGTTTCTTGTTGG + Intronic
1161335881 19:3713057-3713079 CTTTGAAGTAGGACTCATGGGGG - Intronic
1202670906 1_KI270709v1_random:50083-50105 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
927094574 2:19737866-19737888 ATTTTAATAGGGAATCTTTGAGG - Intergenic
928250144 2:29669494-29669516 ATGTGAAGTGGGGTTCTTGAAGG + Intronic
929353751 2:40993943-40993965 ATTAGAGGTGGGAATCATTGGGG + Intergenic
929878162 2:45814230-45814252 ATTGGAAGTGGCAAACTTGACGG + Intronic
932873949 2:75431193-75431215 ATTTGAAGTGGGGGGCTGGGGGG + Intergenic
933327161 2:80852649-80852671 TTTTGAAGAGGGGACCTTGGAGG + Intergenic
934250521 2:90350181-90350203 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
934259045 2:91453229-91453251 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
934302352 2:91785140-91785162 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
934904577 2:98187444-98187466 ATGTGCAGTGGGGTTCTTGGTGG + Intronic
935366710 2:102300279-102300301 ATTTAAAGTTGGATTCTTGTTGG + Intergenic
935624402 2:105158279-105158301 ATTTGAAGTGGGTTTCTTATAGG - Intergenic
936259001 2:110942310-110942332 ATTTGAAGTGGGTTTTTTGTAGG - Intronic
936287901 2:111195313-111195335 TTTTAAGGTGTGAATCTTGGGGG - Intergenic
936878263 2:117218630-117218652 ATTTGAAGTTGGCATCTTCAAGG - Intergenic
938520240 2:132062709-132062731 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
938632300 2:133180118-133180140 ACTTGCATTAGGAATCTTGGAGG + Intronic
940917732 2:159275688-159275710 ATAAGAAATGGGAATTTTGGGGG - Intronic
942211127 2:173671438-173671460 ATTTAAACTGGAAATCTTAGAGG - Intergenic
942211409 2:173674761-173674783 ATTTAAACTGGAAATCTTAGAGG + Intergenic
942747043 2:179245890-179245912 ATTTGAAGTGAGTTTCTTGTAGG - Intronic
943257219 2:185611241-185611263 ACTTGAAGTGGTGATCTTAGTGG - Intergenic
945887790 2:215394988-215395010 CTTTAAAGTGAGGATCTTGGCGG - Intronic
947443535 2:230144141-230144163 TTTTGAATTGGGAATCTAAGTGG + Intergenic
948438971 2:237973886-237973908 CTTTGAAGTCGGTTTCTTGGGGG + Intronic
1168831321 20:846701-846723 ATGAGAAGTGGGAGTTTTGGAGG + Intronic
1169442954 20:5648318-5648340 TTTTTAAGTGAGAATGTTGGAGG - Intergenic
1170079953 20:12463812-12463834 ATTTGACTTGGCAATTTTGGTGG - Intergenic
1171974239 20:31583978-31584000 ATGGGAAGTGGGGACCTTGGAGG - Intergenic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1176776402 21:13138063-13138085 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1177296464 21:19182656-19182678 AGTGGAGCTGGGAATCTTGGAGG - Intergenic
1179601753 21:42482775-42482797 ATTTGAGGTGGGTATTGTGGTGG - Intronic
1180524403 22:16241335-16241357 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1203324004 22_KI270737v1_random:99710-99732 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
950160153 3:10754383-10754405 ATTTGAGGTTGGAATCTCAGAGG - Intergenic
951156230 3:19356921-19356943 ATTTGAATTTGTAATCTTGGTGG + Intronic
951458712 3:22924686-22924708 ATTTGAAGTGTGTTTCTTGTAGG - Intergenic
952175584 3:30859107-30859129 CTTTGAAGTGAGAATGTAGGAGG + Intronic
952344464 3:32470892-32470914 CTTTCAAGTGGTCATCTTGGGGG + Intronic
952549856 3:34464494-34464516 ATTTGAAGTGAGAATAAAGGTGG + Intergenic
954261881 3:49445055-49445077 ATTTAAAGTAAGACTCTTGGGGG + Intergenic
955602769 3:60665668-60665690 ATTTGAAGTGAGTTTCTTGTAGG + Intronic
965606164 3:170499475-170499497 ATTTGAAGTGGGAACCATCCTGG + Intronic
965782653 3:172304181-172304203 ATTTTTAGTGGGATTCTTGGAGG - Intronic
967212943 3:187185044-187185066 ATTTGAACTGGGCAGCCTGGTGG - Intergenic
967509810 3:190296863-190296885 AAGTGATGTGGAAATCTTGGAGG + Intergenic
970129012 4:12845874-12845896 ATTTGAATTGGGGAACTTGAAGG - Intergenic
971065169 4:23023329-23023351 AAATGCAGTGGGAATATTGGAGG - Intergenic
973582068 4:52353916-52353938 TTTGGAGGTGGGATTCTTGGAGG - Intergenic
974887512 4:67838109-67838131 ATTTGAATTGGTAAACTTGAGGG + Intronic
975058473 4:69966310-69966332 ACTTGAAGAGGGAATCTGGGTGG + Intergenic
976257515 4:83113720-83113742 TAGTGAAATGGGAATCTTGGTGG + Intronic
982795516 4:159639088-159639110 CTTTGAAGTAGGAAACATGGAGG + Intergenic
983721858 4:170864885-170864907 ATCTGAATTGGGGAGCTTGGTGG + Intergenic
984642851 4:182189193-182189215 CTTTGATGTGTGATTCTTGGTGG + Intronic
985842161 5:2315571-2315593 ATTTGAAGTGAGTTTCTTGTGGG + Intergenic
986541951 5:8853687-8853709 ATTTGAAATGTGAATTTTGGTGG + Intergenic
987671346 5:21013968-21013990 ATTTGACGAGGGTATGTTGGAGG + Intergenic
988223473 5:28380203-28380225 ATTAGAAGTGGTAAGCTTTGGGG - Intergenic
990593969 5:57294662-57294684 TTTGGAAGTGGGCATCTTTGGGG + Intergenic
991571277 5:68055864-68055886 ATTTTAAGTGGGAGTCCTGGTGG - Intergenic
991593624 5:68279851-68279873 ATTTGAGGTGGTATTGTTGGGGG - Intronic
994789572 5:104206470-104206492 ATTCAAAGTTGGAATCTTGTGGG + Intergenic
995906002 5:117124049-117124071 ATTTAAAGTGGGTTTCTTGTAGG + Intergenic
996177266 5:120374242-120374264 GTTTGCAGTGGGAATTTTGCAGG + Intergenic
997626644 5:135335734-135335756 ATTTGAAGTGGAAATGTGTGTGG - Intronic
1000919974 5:167126761-167126783 ATTTAAAATGGTAATCTTTGGGG - Intergenic
1001327112 5:170737102-170737124 CTTAGAAGTGGCAATCTTGTTGG - Intergenic
1001929253 5:175661101-175661123 ATTCCAAGTGGGAAGTTTGGAGG - Intronic
1003126852 6:3362653-3362675 ATTTGTAGATGGCATCTTGGGGG - Intronic
1005075833 6:21906382-21906404 ATTTTAAGGGGGAAATTTGGGGG - Intergenic
1007331000 6:41108470-41108492 GTTTGAAGTGGCAATCATGAGGG + Intergenic
1007690527 6:43698267-43698289 ATTGGAGGTGGGAAGCTTGAAGG - Intergenic
1009412350 6:63380362-63380384 ATTTGAATTGGTATTCTTGATGG + Intergenic
1010094574 6:72026149-72026171 ATTTTCAGTGGCTATCTTGGAGG + Intronic
1013440969 6:110168557-110168579 ATTTGAAGTGGGAATCTTGGAGG - Intronic
1013576650 6:111489869-111489891 ACTTGAAGTATGAATGTTGGCGG - Intergenic
1014692013 6:124573489-124573511 ATTTTAAGTGGTCTTCTTGGTGG + Intronic
1017675736 6:156811780-156811802 TTTTGATGTAGGAATTTTGGTGG + Intronic
1018490846 6:164291502-164291524 ATTTCAACTGGGATTCTTGGTGG + Intergenic
1019737337 7:2657048-2657070 CTTTGAAGTGGGGGTCCTGGTGG + Intronic
1020563850 7:9771466-9771488 ATTTGAAATGGGAATCGTGTTGG - Intergenic
1022512358 7:30947469-30947491 ATTTAAAATGGGTTTCTTGGAGG + Intronic
1023996970 7:45164848-45164870 ATTTAAAGTTGGATTCTTGTTGG + Intronic
1024806329 7:53145765-53145787 ATTTTAAGTGGCAATGTTAGGGG - Intergenic
1025479712 7:60966764-60966786 ATTTTAAGTGGCAATGTTAGAGG + Intergenic
1025552252 7:62265572-62265594 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1025558060 7:62334645-62334667 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1025990051 7:66490902-66490924 TTATGATGTGGGCATCTTGGGGG - Intergenic
1026038691 7:66847669-66847691 TTATGATGTGGGCATCTTGGGGG + Intergenic
1028208247 7:88041242-88041264 CCTTGGGGTGGGAATCTTGGGGG + Intronic
1031522626 7:122785219-122785241 ATGTGAAGTAGCAATGTTGGAGG - Intronic
1032437974 7:131917305-131917327 ATTTGAAGTGGGTTTCTTACAGG - Intergenic
1033878612 7:145854519-145854541 ATTTGCAGTGAGAATCCTTGAGG + Intergenic
1033987433 7:147243430-147243452 ATGTGAATTGGGAATGATGGGGG - Intronic
1034955520 7:155331994-155332016 ATTTAATGTGAAAATCTTGGGGG - Intergenic
1035068725 7:156125699-156125721 TTTTCAATTGGGAATTTTGGCGG + Intergenic
1035367115 7:158356420-158356442 ATTTGAAGTGGGAATGTGATAGG - Intronic
1035793436 8:2329955-2329977 ATTTGAAGTGTGTTTCTTGTAGG + Intergenic
1035799368 8:2391750-2391772 ATTTGAAGTGTGTTTCTTGTAGG - Intergenic
1035874346 8:3171338-3171360 ATTTGAAGTGGAAATCAGGCTGG - Intronic
1036423423 8:8619327-8619349 ATTTGAAGTGGGTCTCTTGTAGG - Intergenic
1037172222 8:15906378-15906400 TTGTGAAGTGGGAATCAAGGTGG + Intergenic
1037215005 8:16438643-16438665 CTTTGAAATGAGAATCTGGGAGG + Intronic
1037282626 8:17259965-17259987 ATATGAAGTGGGTTTCTTGTAGG + Intronic
1037646937 8:20800688-20800710 ATCTGAAATGAGAATCTCGGGGG + Intergenic
1038646000 8:29362737-29362759 ATTCCAAGTGGAAATCCTGGTGG - Intergenic
1039578105 8:38641852-38641874 ATTTGAAGTGGGATTTGTGTGGG - Intergenic
1039722949 8:40184543-40184565 ATTTCAAATAGGAATTTTGGAGG - Intergenic
1040587913 8:48761876-48761898 ATTTGAAGTGAGTTTCTTGTAGG + Intergenic
1040595406 8:48833360-48833382 ATTTGAAGGGGGAAGCTTCGTGG + Intergenic
1041718174 8:60950865-60950887 ATTTGGAGTGGGCATATTTGTGG + Intergenic
1041750963 8:61260593-61260615 ATCTGGAGTGGGCATCTGGGAGG + Intronic
1042014200 8:64289254-64289276 ATTTAAAGTGGGTTTCTTGTAGG + Intergenic
1042154290 8:65825622-65825644 AGATGAAGGTGGAATCTTGGAGG + Intronic
1042174893 8:66029105-66029127 ATGTGAAGCAGGAATCCTGGAGG - Intronic
1043514776 8:80985933-80985955 ATTTGAGGTAGGAATGTTGGTGG - Intronic
1043715559 8:83481188-83481210 ATTTTAAGTGGGAAAAATGGTGG - Intergenic
1043775864 8:84267263-84267285 ATTTGAAGTGGATATTTTGAGGG - Intronic
1045976893 8:108139577-108139599 ACTTGAAATGGGAATCTTTCAGG - Intergenic
1046360023 8:113139801-113139823 ATTTGAAGTGGGATTCTTATAGG - Intronic
1050035943 9:1436334-1436356 TTTTGAAGAGCGAAACTTGGTGG + Intergenic
1052755335 9:32535221-32535243 AATTGGAGTGTGAATCTTGGAGG - Intergenic
1053699529 9:40675553-40675575 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1054310818 9:63474954-63474976 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1054409607 9:64799105-64799127 ATTTTAAGTGGCAATGTTAGAGG - Intergenic
1054903201 9:70391018-70391040 ATTAGAAGTGGTTTTCTTGGAGG + Intronic
1054972053 9:71099319-71099341 ATTAGAAGGTGGAATCTTTGGGG - Intronic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1056291780 9:85150756-85150778 ATTTGAAGGGGGAACCTGAGGGG - Intergenic
1057709375 9:97424676-97424698 ATTTAAAGTGGGTTTCTTGAAGG + Intronic
1057909340 9:99005593-99005615 ATTTGAGGTGGGAACATAGGAGG - Intronic
1058978595 9:110148118-110148140 ATTTGAAGAGAGGATCTTGGTGG + Intronic
1062222501 9:135424974-135424996 ACTTGAAGTGGGAGGCTGGGGGG - Intergenic
1187621282 X:21058750-21058772 ATTTTAAGTGGATATCTTGTAGG + Intergenic
1188428584 X:30078114-30078136 ATTTTAAGTGGCAATTTTTGAGG - Intergenic
1188800213 X:34520609-34520631 ATATGAATTGGGATTTTTGGTGG + Intergenic
1190040230 X:47065389-47065411 ATTTAAAGTGGGCTTCTTGTAGG - Intergenic
1190890517 X:54563240-54563262 GTTTGATGTGGGATTTTTGGTGG + Intergenic
1191936349 X:66431252-66431274 ATTGGGGGTGGGAATCTTAGAGG - Intergenic
1192268257 X:69555419-69555441 AGTTGGAGTGGGATTCTGGGTGG + Intergenic
1193368743 X:80666796-80666818 ATTTGCAGAAGGATTCTTGGTGG - Intergenic
1194770452 X:97897561-97897583 ATTTGAAGAGGGACACATGGAGG - Intergenic
1194909375 X:99620878-99620900 ATTGATAGTGGGAAACTTGGGGG + Intergenic
1195974374 X:110510193-110510215 ATTAGAGGTTGAAATCTTGGGGG + Intergenic
1197394640 X:125911599-125911621 ATTTCAAGTGAGAATCTCTGAGG - Intergenic
1198576633 X:138017138-138017160 TTTTGATGTGGAAATTTTGGGGG + Intergenic
1198873200 X:141197195-141197217 AATACCAGTGGGAATCTTGGTGG + Intergenic
1198951131 X:142073766-142073788 ATTAGAAGATGGAATCTTTGGGG - Intergenic
1199162538 X:144630063-144630085 ATTTTAAGTGGGAACCTTACAGG + Intergenic
1202364560 Y:24148510-24148532 ATTTGGAGAGGAAAACTTGGGGG + Intergenic
1202506221 Y:25521612-25521634 ATTTGGAGAGGAAAACTTGGGGG - Intergenic