ID: 1013441779

View in Genome Browser
Species Human (GRCh38)
Location 6:110179167-110179189
Sequence CAGCGAGAGCAGCCCCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013441772_1013441779 2 Left 1013441772 6:110179142-110179164 CCTCAGGTGACACCCACAGTCTC 0: 1
1: 0
2: 2
3: 25
4: 273
Right 1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 217
1013441771_1013441779 15 Left 1013441771 6:110179129-110179151 CCGGGCGGTGGCACCTCAGGTGA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 217
1013441773_1013441779 -10 Left 1013441773 6:110179154-110179176 CCCACAGTCTCTCCAGCGAGAGC 0: 1
1: 0
2: 0
3: 9
4: 104
Right 1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 217
1013441770_1013441779 16 Left 1013441770 6:110179128-110179150 CCCGGGCGGTGGCACCTCAGGTG 0: 1
1: 0
2: 1
3: 12
4: 146
Right 1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013441779 Original CRISPR CAGCGAGAGCAGCCCCGGGG CGG Intronic
900435765 1:2629823-2629845 CAGCATGAGCAGCCCAGGGGGGG - Intronic
900622283 1:3592961-3592983 CAGCCCGGGCTGCCCCGGGGAGG + Intronic
901035630 1:6334428-6334450 CAGGCAGAGCAGCCCAGGGGAGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
904341794 1:29839936-29839958 CAGGGAGAGAAGCCCAGAGGAGG - Intergenic
904352904 1:29920522-29920544 CAGCGTGGGCAGCCAAGGGGAGG - Intergenic
904995266 1:34626587-34626609 AAGCGGGAGCAGCCCAGTGGTGG + Intergenic
907275500 1:53314633-53314655 CAGGAAGAGCAGTCCAGGGGCGG + Intronic
907321769 1:53606975-53606997 CAGAGTGAGCAGCCCAGGGCGGG + Intronic
913994772 1:143643065-143643087 CAGGGAAAGTAGCCCCGGTGGGG + Intergenic
915083816 1:153370776-153370798 CAGAGGGAGCAGCCACGGGAGGG + Intergenic
915736642 1:158089474-158089496 CAGAGAGAGCAGCCTCGGGTGGG - Intronic
916179167 1:162069610-162069632 CAGCGCGGGCAGCGCGGGGGCGG + Intergenic
916717012 1:167455047-167455069 CAGCGGGAGGAGCCCAGGCGCGG - Intronic
920061957 1:203233070-203233092 CAGGGAGGGCAGCCCCAGGAGGG - Intronic
921384129 1:214552094-214552116 CGGCGGGAGCAGCCCAGGGTTGG - Intronic
922325997 1:224529071-224529093 CAGGGAGAGCTGCCTGGGGGAGG - Intronic
924038791 1:239963280-239963302 CAGCAAGAGCAGCCCTGGGCTGG - Intergenic
1062947965 10:1475130-1475152 CAGCAGGAGGACCCCCGGGGAGG + Intronic
1067478070 10:46579153-46579175 CTGCGGGAGCAGCCCCATGGCGG + Exonic
1067616670 10:47762634-47762656 CTGCGGGAGCAGCCCCATGGCGG - Intergenic
1067720211 10:48722402-48722424 CAGGGAGAGCTGCCCTGAGGAGG + Intronic
1067806129 10:49394956-49394978 CAGTGAGAGCAGCCCAGCGACGG + Intronic
1069229895 10:65996246-65996268 CAGTGGGAGCAGCCCCAGGCAGG + Intronic
1070129658 10:73647687-73647709 CAGCGATAGCAGCTCGGGGTTGG + Exonic
1070162584 10:73874716-73874738 CAGCGAGGGCGGCTCCGGGGCGG - Intergenic
1071463019 10:85916366-85916388 CAGCCAGAGCAGGCCCCAGGGGG - Intronic
1071570924 10:86696411-86696433 CTGCCTGAGCAGCCCCTGGGAGG + Intronic
1073074039 10:100812301-100812323 GAGCTAGAGCAGCCCAGCGGCGG - Intronic
1073328599 10:102656799-102656821 CGGCGTGAGCAGCTCTGGGGCGG + Exonic
1076143102 10:128095490-128095512 CATCGAGAGCTCCCCCTGGGAGG + Intergenic
1076504759 10:130964318-130964340 CAGCGAGAGCATGCACGGTGAGG + Intergenic
1076756090 10:132572488-132572510 CAGGGAAAGCAGCCCCGGGCGGG - Intronic
1076851269 10:133094501-133094523 CGGCCACAGCAGCCCCAGGGAGG + Intronic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1080793980 11:35546444-35546466 CCGAGTGAGCAGCCCCAGGGAGG - Intergenic
1081964541 11:47161537-47161559 CAGGGAGAGCCAACCCGGGGAGG - Exonic
1083615071 11:64022116-64022138 AGGCAAGAGCAGCCCCTGGGGGG + Intronic
1088042729 11:105407287-105407309 CAGCCTTAGCAGCCCCAGGGTGG - Intergenic
1089069586 11:115689158-115689180 CAGCGAGGGAAGGGCCGGGGAGG - Intergenic
1089555703 11:119315100-119315122 CTGCAAGAGCAGCCCGGGGAGGG - Intronic
1090472245 11:126990496-126990518 CAGAGAGAGCAGAGCCCGGGAGG - Intronic
1090658366 11:128862506-128862528 CTTCTAGGGCAGCCCCGGGGGGG - Intronic
1091219318 11:133920793-133920815 CAGCAGCAGCAGCCCTGGGGAGG - Exonic
1092027511 12:5254919-5254941 CAGAGAGAGGAGCCTGGGGGTGG + Intergenic
1096121172 12:49090321-49090343 CAGGAAGAGCAGCACCGGCGTGG + Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097079719 12:56421218-56421240 CCGAGAGAGCAGGCGCGGGGGGG - Intronic
1098286096 12:68908321-68908343 CAGAAAGAGTAGCCCCGGGTTGG - Intronic
1104761337 12:131299053-131299075 CAGGGAGCGCAGCCCCAGGTGGG + Intergenic
1104818438 12:131661739-131661761 CAGGGAGCGCAGCCCCAGGTGGG - Intergenic
1104987640 12:132605967-132605989 GAGCGAGTGCAGCCTCAGGGAGG + Intronic
1105293991 13:19072585-19072607 CAGCCAGACCAGCACCTGGGAGG - Intergenic
1105913544 13:24892663-24892685 CATAGAGAGCAGCCTCGAGGTGG - Exonic
1106488135 13:30190715-30190737 AAGCCAGAGCAGGCCAGGGGTGG + Intergenic
1111672639 13:91348610-91348632 CCGCGTGGGCAGCCTCGGGGCGG + Intergenic
1112091718 13:96090551-96090573 CTGAGAGAGCCGCGCCGGGGCGG + Intergenic
1113379039 13:109786420-109786442 CGGCGGCAGCAGCCCCGGTGCGG - Exonic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1115610735 14:35046502-35046524 CAGCGCCAGCAGCCCTGTGGTGG + Exonic
1118830007 14:69421995-69422017 CAGTGAGTGCAGCCCAGGGAGGG - Intronic
1119602056 14:75982810-75982832 CTGCGAGAGCGGCTCCGGAGCGG - Intronic
1121337859 14:93088178-93088200 CAGGGAGAGCAGGCCTGGGTGGG - Intronic
1122613964 14:103004158-103004180 CAGCCTCAGCAGCCTCGGGGTGG - Intronic
1122951536 14:105047723-105047745 CTGCCAGAGCAGACGCGGGGCGG + Intergenic
1123110841 14:105866260-105866282 CAGCCAGTGCAGGCCTGGGGAGG - Intergenic
1202899820 14_GL000194v1_random:28491-28513 CACGGAGAGCATCGCCGGGGCGG + Intergenic
1125539164 15:40459755-40459777 TAGCGAGAGGAGCCCCAGGGAGG - Exonic
1125698670 15:41660788-41660810 CAGAGAGAGCGGCCACGAGGCGG + Intronic
1129052844 15:72796990-72797012 CCGCGAGAGCGGCCGCGGCGCGG + Intergenic
1131171951 15:90185025-90185047 CAGGAAGAGCGGCCCCGCGGGGG + Intronic
1131179739 15:90231599-90231621 CAGCGAGCTCAGCCTCGTGGGGG + Intronic
1133118152 16:3589896-3589918 CCGTGAGAGCAGCCCCAGCGAGG - Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1135150630 16:20002300-20002322 CAGCGGGAGCAGCACTTGGGAGG + Intergenic
1135429921 16:22374396-22374418 CAGCCAGAGCCGCCCTCGGGCGG + Exonic
1136566465 16:31073527-31073549 CAGCGCGAGCAGCGCGGGCGGGG - Intronic
1139531161 16:67543295-67543317 CAGGGAGGGCAGCCAGGGGGCGG + Intronic
1141695502 16:85617241-85617263 AAGTGAGAGCTGCCCCCGGGAGG + Intronic
1143140290 17:4738743-4738765 CTGCGAGGGCAGCGCCTGGGCGG - Intronic
1143177855 17:4966963-4966985 CAACACGAGCAGCCCCGGGGAGG + Intronic
1143239965 17:5435477-5435499 CACCGAGAGCAGCCCTGGAACGG + Intronic
1144608830 17:16690577-16690599 CAGCGAGAGCAAGCACGGTGAGG + Exonic
1144854131 17:18258684-18258706 CAGCGAGAGCGGCGCCATGGAGG - Exonic
1144903994 17:18625249-18625271 CAGCGAGAGCAAGCACGGTGAGG - Intergenic
1144954090 17:19010450-19010472 CAGAGTAAGCAGCCCCGGGGAGG - Intronic
1145128591 17:20321493-20321515 CAGCGAGAGCAAGCACGGTGAGG + Intergenic
1145196029 17:20895822-20895844 CAGCGAGAGCAAGCACGGTGAGG - Exonic
1146160898 17:30559136-30559158 CACAGAGGGCAGCCACGGGGAGG - Exonic
1147386202 17:40083826-40083848 CGGCGAAAGAAGCCCTGGGGTGG - Exonic
1148072618 17:44916908-44916930 CAGCAAGGGCAGCCCCTAGGGGG + Intronic
1148113545 17:45161440-45161462 CAGTGAGAGCACCCCGTGGGGGG - Intronic
1148146181 17:45366478-45366500 CACCCAGAGCAGGCCAGGGGTGG - Intergenic
1151684460 17:75638634-75638656 CAGTGAGACCCGTCCCGGGGGGG + Exonic
1151986052 17:77544538-77544560 CAGCCAGAGCAGCCCCACGCGGG + Intergenic
1153056369 18:950059-950081 CAGTGGTAGCAGCCCCAGGGAGG + Intergenic
1158732285 18:60037543-60037565 CAGCAAGAGCAGCCACTGTGAGG + Intergenic
1159685471 18:71413685-71413707 CAGAGTGAGCAGCCCCTGGATGG - Intergenic
1159798013 18:72867492-72867514 GAGCGAGAGCCCGCCCGGGGCGG - Exonic
1160237551 18:77098004-77098026 CAGCAAGAGAAGCTACGGGGAGG - Intronic
1160526893 18:79543622-79543644 CAGGGAGACCAGGCCTGGGGAGG + Intergenic
1160665796 19:327605-327627 CAGAGAGACCAGTCCTGGGGAGG + Intronic
1160763571 19:797576-797598 GGGCGAGATCGGCCCCGGGGAGG - Intronic
1161027273 19:2042427-2042449 CGGAGTGAGCAGCTCCGGGGTGG + Exonic
1161166242 19:2789356-2789378 CAGCGAGAGCAGCTGCGGGAAGG - Intronic
1161262797 19:3346801-3346823 TGGCGAGGGCAGCTCCGGGGAGG + Intergenic
1161399147 19:4059846-4059868 CAGCCAGAGCACCCCCGGCGGGG + Intronic
1161650280 19:5480116-5480138 CAGAGAGAGCAGCCCCAGGAAGG + Intergenic
1161818815 19:6516699-6516721 CAGCGAGGGCAGGGTCGGGGAGG - Intergenic
1162081453 19:8220261-8220283 CAGAGACAGGAGCCTCGGGGAGG - Intronic
1162758811 19:12876105-12876127 CAGGGAGAGGAGCAACGGGGTGG - Exonic
1162930232 19:13953863-13953885 AGGCCAGAGCTGCCCCGGGGAGG + Intronic
1166106820 19:40601658-40601680 CCGAGAGAGCGGCTCCGGGGGGG + Intronic
1166369639 19:42293714-42293736 CAGCGAGAGCAGCAGTGGGCGGG + Exonic
1166921440 19:46231514-46231536 CATCGGGAGCAGCCCAGGTGGGG + Intergenic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
925970446 2:9103206-9103228 CAGTGAGAGCAGCCCAGGGATGG + Intergenic
926077273 2:9951550-9951572 CGGCGAGAAGAGCGCCGGGGCGG - Intergenic
927278501 2:21282268-21282290 CAGCGAGAGCTTGGCCGGGGAGG - Intergenic
927971365 2:27307805-27307827 CAGCCAGAGGAGCCCCGAGGCGG - Exonic
927990200 2:27442286-27442308 CAGGGGGAGCGGGCCCGGGGCGG + Intergenic
928178593 2:29051868-29051890 CAGCGGGAACATCCGCGGGGTGG + Exonic
929242293 2:39665724-39665746 AAGCGAGAGCGGCGCGGGGGAGG + Intronic
930663786 2:54082064-54082086 CAGGGAGAGCAGCTCCAGGCTGG - Intronic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
933778415 2:85785638-85785660 CAGTGAGAGCAGCCTCTGTGTGG + Intronic
935203819 2:100881067-100881089 CAGCGTCAGCATCCCTGGGGTGG - Intronic
937091403 2:119208909-119208931 CAGCCAGGGCAGCCCCAGCGGGG - Intergenic
937230941 2:120397780-120397802 CAGCGACAGGAGCCCGGGGTGGG + Intergenic
937909777 2:127069840-127069862 CAGAGGGAGCAACCCCGGAGGGG + Intronic
938169199 2:129059764-129059786 TGGAGAGAGCAGCCCTGGGGTGG - Intergenic
940396634 2:153197892-153197914 CAGGGATAGCAGCCCCAGGCAGG + Intergenic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
947771460 2:232673601-232673623 CAGGGAAAGCAGCCCAGGGGAGG - Intronic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948547860 2:238745539-238745561 CTCCCAGAGCAGCCCCTGGGAGG + Intergenic
948980737 2:241493331-241493353 CAGCGTGAGCATCCCCAGGGAGG + Exonic
1171248753 20:23633461-23633483 CAGGGAGAGCAGCCAGGGGCTGG - Intronic
1171519454 20:25764827-25764849 CAGTGAGCGCAGACCCTGGGTGG - Intronic
1175256882 20:57652973-57652995 CAGCGGGAGCAGCCCAGGGTGGG + Intronic
1175857964 20:62132969-62132991 CACAGAGAGGAGCCCTGGGGAGG - Intronic
1175895086 20:62332574-62332596 CAGGGAGAGCAGCCCCTGCTGGG + Exonic
1175922345 20:62456061-62456083 CAGCCAGAGCCGCCCCGCGGAGG - Intergenic
1175966089 20:62660913-62660935 CAGCCCTCGCAGCCCCGGGGAGG - Intronic
1176030222 20:63008027-63008049 CAGTGTGCGCAGCCCCGGGAGGG + Intergenic
1176216943 20:63952466-63952488 GGCCGAGAGCAGCCCCGTGGAGG - Intronic
1176619194 21:9043265-9043287 CACGGAGAGCATCGCCGGGGCGG + Intergenic
1179142064 21:38734375-38734397 CACCGAGTGCAGCCCTGGGCCGG + Intergenic
1180105468 21:45615607-45615629 AAAACAGAGCAGCCCCGGGGGGG + Intergenic
1180948444 22:19709450-19709472 CACAGAGAGCAGCCCAGGGTAGG - Intergenic
1181344848 22:22211563-22211585 CAGGAAGAGCAGCCCTTGGGAGG - Intergenic
1181871056 22:25899685-25899707 CAGCCAGAGCACCCACAGGGAGG - Intronic
1182104407 22:27679078-27679100 CAGAGAGGGCAGCTCCTGGGTGG - Intergenic
1183380562 22:37488665-37488687 CAGGGAGAGCAGCCCAGGCAGGG + Intergenic
1183394881 22:37566102-37566124 CAGAGAAAGCACCCCCGAGGTGG - Exonic
1184923044 22:47619099-47619121 CAGTGAGAAAAGCCCCGGGCTGG - Intergenic
950004236 3:9681297-9681319 GAGGGACAGCAGCCCCAGGGAGG - Intronic
950161067 3:10761656-10761678 CACTGAGGGCAGCCTCGGGGGGG - Intergenic
950469317 3:13174759-13174781 CAGCGAGGGCAGCTCTGAGGGGG - Intergenic
950674700 3:14547698-14547720 CAGTCAGAGCAGCCCCTGAGGGG - Intergenic
950701344 3:14751374-14751396 CAGCGGGTGCAGCCCCCGGAGGG + Intronic
953771219 3:45779897-45779919 CAAGGTGAGCAGCCTCGGGGCGG - Intronic
953885686 3:46713260-46713282 AAGCGAGAGCAGGCCCGGCAAGG - Intronic
954306303 3:49727292-49727314 CAGCAACACCAGCCCCGAGGCGG - Exonic
960674507 3:120181347-120181369 CAGCAGGAGCAGACCCTGGGGGG + Exonic
961340499 3:126213935-126213957 CAGGGACAGCAGCCGCGCGGAGG + Intergenic
961869301 3:129976235-129976257 CACAGAGAGCAGGCCCTGGGTGG + Intronic
967219074 3:187234273-187234295 CAGCCAGAGAAGCCCCTGAGAGG - Exonic
968452896 4:683467-683489 CAGCCAGGGTGGCCCCGGGGTGG - Intronic
968515840 4:1015313-1015335 CAGGGAGTGCAGCCCTGGAGGGG - Intronic
968948323 4:3677140-3677162 CAGCGGGAGGAGCCCGGGGCTGG + Intergenic
968969029 4:3783971-3783993 GAGCAAGCACAGCCCCGGGGCGG + Intergenic
969158685 4:5236015-5236037 CAGCCAGAGCAGCCAGGAGGGGG + Intronic
969230214 4:5825344-5825366 CAGTGAGAGCAGGCTCGGGTGGG + Intronic
979998802 4:127464471-127464493 CAGTGAGTGCAGCCCCTGGAGGG - Intergenic
980956109 4:139430819-139430841 CAGTGAGAGCAGAACCCGGGTGG + Intergenic
985880522 5:2635711-2635733 AAGGGAGAGCAAGCCCGGGGTGG + Intergenic
986241665 5:5965454-5965476 CAGAAAGTCCAGCCCCGGGGGGG + Intergenic
986311794 5:6556723-6556745 CATCGTGAGCAGCCCCTTGGAGG - Intergenic
986707394 5:10463375-10463397 CAGAGAGAGCAGCCCAGGGCTGG + Intronic
988332553 5:29860982-29861004 CAGCAAAAGCAGCCCCTTGGAGG + Intergenic
988577884 5:32444424-32444446 CCGTGAGAGCAGCCCTGGCGGGG + Intronic
990040813 5:51377455-51377477 TGGCGAGCGCAGCCCCTGGGAGG - Intergenic
992164039 5:74031090-74031112 CAACAAAAGCAGCCCCGGTGGGG - Intergenic
995764625 5:115602153-115602175 CAGCGAGAGCGCCCAGGGGGTGG + Exonic
997590715 5:135070463-135070485 CAACAAGAGCAGCTCTGGGGGGG + Intronic
998183466 5:139961532-139961554 CAGCGACAGCAACCCCGTAGGGG + Intronic
1001292211 5:170471728-170471750 CAGAGAGAGAGGCCCCAGGGTGG - Intronic
1001732407 5:173970098-173970120 CAGGGAGAGCAGAGCCTGGGGGG + Intergenic
1002133380 5:177094593-177094615 CAGCAAGAGCACCCCGGGGCTGG - Intronic
1002291804 5:178205252-178205274 GCGCGCGAGCGGCCCCGGGGCGG - Intronic
1002303925 5:178272620-178272642 CAGCTAGGGCAGCTCCTGGGAGG - Intronic
1003872191 6:10412396-10412418 GAGGGAGAGGAGCCCCGGGTGGG + Intronic
1006259096 6:32853573-32853595 ATGCGAGAGAAGCTCCGGGGAGG + Exonic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1014725087 6:124963074-124963096 CGGCGAGAGCTGCTCCGAGGCGG - Exonic
1018635179 6:165854481-165854503 CCGCGAGAGCCGCCCGGAGGTGG - Intronic
1018774216 6:166998869-166998891 CAGCCCCTGCAGCCCCGGGGGGG - Intergenic
1019194061 6:170271155-170271177 CAGCGAGAGCTCCCCAGGAGGGG - Intergenic
1020046791 7:5046331-5046353 CAGCGACAGCAGCCCCGCCCCGG + Exonic
1020292165 7:6730258-6730280 CAGCGACAGCAGCCCCGCCCCGG + Intergenic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1023822271 7:43986775-43986797 TGGCGAGAGCAGCCCGGGGAGGG + Intergenic
1024048335 7:45600402-45600424 CAGGGAGAGCAGCCATGGGAAGG + Intronic
1024195237 7:47052768-47052790 CTCCGAGAGCAGCCCCGGCCCGG - Intergenic
1027121807 7:75527608-75527630 CAGCGACAGCAGCCCCGCCCCGG - Intergenic
1027232645 7:76281675-76281697 GAGCGCGACGAGCCCCGGGGGGG - Exonic
1029663325 7:101978342-101978364 TAGCCTGAGCAGCCCCTGGGTGG - Intronic
1029750536 7:102540189-102540211 TGGCGAGAGCAGCCCGGGGAGGG + Intronic
1029768489 7:102639297-102639319 TGGCGAGAGCAGCCCGGGGAGGG + Intronic
1030216020 7:107044687-107044709 GAGCGAGCGCGGCCCCGGGAGGG - Exonic
1033162004 7:139006137-139006159 CAGAGAGAGCAGCCCCCTGAGGG - Intergenic
1034414755 7:150958534-150958556 GATCGCGAGCAGCCCCGGAGCGG + Intronic
1036697112 8:10982827-10982849 CAGAGAGCGCAGCCCCAGGGAGG + Intronic
1037878763 8:22562378-22562400 CAGAGAGAGGAGCCCCTTGGAGG + Intronic
1037960282 8:23092677-23092699 CAGCCAGAGAACCCCGGGGGAGG - Intronic
1037971790 8:23177042-23177064 CAGCCAGAGGACCCCCCGGGAGG + Intergenic
1042902832 8:73746345-73746367 CGGCGAGTGCAGCCACGGTGTGG - Intronic
1045507871 8:102791251-102791273 CAGGCAGAGCCTCCCCGGGGGGG + Intergenic
1048968425 8:139630410-139630432 CCGGGAGAGAGGCCCCGGGGAGG - Intronic
1049377235 8:142295073-142295095 CAGGGAGGGGAGCCCCAGGGAGG + Intronic
1049429203 8:142551340-142551362 CCCCCACAGCAGCCCCGGGGTGG - Intergenic
1049619191 8:143590172-143590194 CAGGGAGGGCAGCCACGGGGAGG - Intronic
1049647518 8:143742299-143742321 CAGCAAGGGAAGCCCCCGGGGGG - Intergenic
1057168649 9:92947610-92947632 CTTCCAGAGGAGCCCCGGGGAGG - Exonic
1057280832 9:93710356-93710378 CAGAGAGAATGGCCCCGGGGAGG - Intergenic
1059247218 9:112858735-112858757 GAGCCAGAGAAGCCCAGGGGTGG - Intronic
1059450828 9:114370574-114370596 CAGAGAGACCAGCCCTGGGAGGG - Intronic
1060722932 9:125990308-125990330 CAGAGAGGGCAGCCACAGGGTGG - Intergenic
1061369918 9:130192415-130192437 CAGGAAGAGCAGCCCCCGAGAGG - Intronic
1061486307 9:130922231-130922253 CAGTGGCAGCAGCCCTGGGGCGG + Intronic
1061506787 9:131036187-131036209 CAGCGAGTGCGGCCCCGACGTGG + Exonic
1190380532 X:49836560-49836582 CAGAGAGTGCAGCCCAGGGCAGG - Intergenic
1190385156 X:49878119-49878141 CAGAGAGTGCAGCCCAGGGCAGG - Intergenic
1192030626 X:67509032-67509054 CAGCGGGTGCAGCCCAGGGAGGG + Intergenic
1194097915 X:89666105-89666127 CAGTGAGGGCAGCCCCAGGCAGG + Intergenic
1196447234 X:115851850-115851872 CCTCGAGAGCAGTCCCGTGGGGG + Intergenic
1196449914 X:115863790-115863812 CCTCGAGAGCAGTCCCGTGGGGG + Intergenic
1196937808 X:120746916-120746938 CAGCAAGAGCAGCCCCTGGCAGG + Intergenic
1197902903 X:131392845-131392867 CACCCAGAGCAGCACCAGGGAGG + Intronic
1199114014 X:143968717-143968739 CATTGAGAGCAGCCCATGGGAGG + Intergenic
1200224762 X:154411455-154411477 CAGCGAGGCCAGCCCCGGGGCGG - Intronic