ID: 1013442160

View in Genome Browser
Species Human (GRCh38)
Location 6:110181218-110181240
Sequence GTGTTAATACAGTGAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 391}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013442159_1013442160 16 Left 1013442159 6:110181179-110181201 CCAACTAGTGAGAGTGCAGTAAA 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG 0: 1
1: 0
2: 2
3: 27
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013442160 Original CRISPR GTGTTAATACAGTGAGAAAA AGG Intronic
903234426 1:21940362-21940384 GTGTACATACAGTGAGATTATGG - Intergenic
903326624 1:22572598-22572620 GTGAGAATCCAGTGAGACAATGG - Intronic
903450015 1:23446827-23446849 GTGTAAATACACTGAACAAAAGG - Intronic
905590281 1:39157332-39157354 TTGTAAAAACAGAGAGAAAAGGG - Intronic
909535725 1:76733997-76734019 GTGAGATTACAGTGAGAAGATGG - Intergenic
909983064 1:82128064-82128086 CTTTTAATAAAGTGATAAAAAGG + Intergenic
910489141 1:87748771-87748793 GAGGTAATACAGAGAGTAAATGG + Intergenic
910700743 1:90071635-90071657 ATGTTTATTCAGTAAGAAAAAGG + Intergenic
911452644 1:98084560-98084582 GTGATAATGAAGGGAGAAAATGG - Intergenic
912272416 1:108224590-108224612 GAGTTAGCAAAGTGAGAAAAGGG + Intronic
912295805 1:108469732-108469754 GAGTTAGCAAAGTGAGAAAAGGG - Intronic
914147320 1:145007418-145007440 GAGTTAAGACAGTGAGAATGAGG - Intronic
915993665 1:160542818-160542840 GTGTTAATACATTTCGACAAAGG - Intronic
916352597 1:163868556-163868578 ATGTTCATACAATGACAAAATGG + Intergenic
917166066 1:172114592-172114614 GTGTTAGTACAGGGAACAAAAGG - Intronic
917435790 1:175019935-175019957 TTGTTAATAGATTGAAAAAATGG - Intronic
917640593 1:176979627-176979649 CTGCTAATACAGTGACAAGAAGG - Intronic
917745626 1:178004086-178004108 TTCTAAATACAGTGCGAAAAAGG + Intergenic
917867015 1:179205691-179205713 GTGTTAATCCACTGAGATTAGGG + Intronic
917941939 1:179931328-179931350 TTGTTAATATACTTAGAAAATGG + Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
919227894 1:194731400-194731422 GTGATAATACAGAGTGGAAAAGG + Intergenic
919251350 1:195060419-195060441 GTGCTCATATATTGAGAAAATGG + Intergenic
919944883 1:202311883-202311905 GTGTTAATACATTGGGAAGAAGG - Intronic
920204539 1:204282079-204282101 GAGACACTACAGTGAGAAAATGG - Intronic
921072340 1:211672018-211672040 AATTTGATACAGTGAGAAAATGG + Intronic
921277444 1:213533814-213533836 GTGTAATTGCAGTGATAAAATGG - Intergenic
922645860 1:227286038-227286060 ATATTAAGACAGTGGGAAAAAGG - Intronic
923049133 1:230378401-230378423 TTCTGAATACAGAGAGAAAAGGG - Intronic
923377635 1:233380297-233380319 GTGAGAACACAGGGAGAAAACGG - Intronic
923745810 1:236699308-236699330 GTCTGATAACAGTGAGAAAACGG + Intronic
923974384 1:239244920-239244942 GTGTTAGTACAATGAAACAATGG + Intergenic
924674190 1:246159236-246159258 GTGGGAATCCAGTGAGAAAAGGG - Intronic
924702073 1:246464191-246464213 GTGTCAGTAGAGAGAGAAAAAGG + Intronic
1063037146 10:2297640-2297662 GTATTCACACAGTAAGAAAATGG - Intergenic
1063416091 10:5873692-5873714 GTGCTCAGACAGTGAGAAGAGGG - Intronic
1064069375 10:12213134-12213156 GTGAATATACAGTGAGAAAGAGG + Intronic
1065492502 10:26296126-26296148 GTGAGGATACAGGGAGAAAAAGG - Intronic
1068395350 10:56454734-56454756 GTGTTAAGTCAGTAAGGAAATGG + Intergenic
1068404086 10:56568099-56568121 ATGTTTATACAGTGTGAAAATGG - Intergenic
1068973582 10:62984193-62984215 TTCTTAATACAGTAAGAGAAGGG - Intergenic
1069845652 10:71369114-71369136 GTGAGAACACAGTGAGAAGATGG + Intergenic
1070173466 10:73950509-73950531 GTGTTCACACAGTGATAAAATGG - Intergenic
1070850008 10:79555977-79555999 GTGTTATTTCAGAGAGCAAATGG - Exonic
1071793691 10:88983269-88983291 ATCATAATACAGTGAGATAAGGG - Intronic
1071865546 10:89726500-89726522 GAGTTAAAAAAGAGAGAAAATGG + Exonic
1072270686 10:93773679-93773701 TTATTAATTCAGTAAGAAAAGGG - Intronic
1072755938 10:98020897-98020919 GTGTCAGTACAGTGTGAAGAAGG + Intronic
1072940660 10:99760689-99760711 GTGTCAGAACAATGAGAAAAAGG - Intergenic
1073530480 10:104227109-104227131 GTGTTAAGATAATGATAAAATGG - Intronic
1077193228 11:1264740-1264762 GTATGAAGACAGTGTGAAAACGG - Intergenic
1078275494 11:9841424-9841446 GTGTTATTTCAGTGATATAATGG + Intronic
1078333742 11:10447320-10447342 GAGTTAATACAGAGAGAAGATGG + Intronic
1078465419 11:11546555-11546577 GTGTTTATCCAGTGAGCAATGGG - Intronic
1078967627 11:16364762-16364784 TTGTAAATCCAGTTAGAAAAGGG + Intronic
1079816087 11:25060307-25060329 GTGAAATTACAGTGAGAAGATGG - Intronic
1079993126 11:27267271-27267293 GTATTAATACATTTAGAAAATGG + Intergenic
1080080813 11:28216358-28216380 ATTTTAATTCATTGAGAAAATGG + Intronic
1080284326 11:30591188-30591210 TTAATAATATAGTGAGAAAAAGG - Intergenic
1080998864 11:37642246-37642268 GTGTTAATAAAGTGAGCACTGGG - Intergenic
1081373892 11:42337025-42337047 GTGGGGATACAGTGAGAAGATGG + Intergenic
1081377084 11:42372660-42372682 TTTTTTATACAGTGTGAAAATGG + Intergenic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1082271530 11:50175032-50175054 TGCATAATACAGTGAGAAAATGG - Intergenic
1085074569 11:73579042-73579064 GTGAGGATACAGTGAGAAGAGGG - Intronic
1085849868 11:80107787-80107809 CTCTTAATGCAGTGAGAGAAGGG + Intergenic
1085968795 11:81561859-81561881 ATGTTAATAATGTGAGAAACTGG + Intergenic
1087751847 11:102014690-102014712 GTGGGAATACACTGAGGAAAGGG + Intergenic
1087771569 11:102215917-102215939 TTGTTAAGAAAGGGAGAAAAAGG - Intronic
1087833893 11:102850585-102850607 GTGATATTACAGACAGAAAAAGG + Intergenic
1088837532 11:113590515-113590537 ATTTTAATACAGGGAGAAGAAGG + Intergenic
1091081089 11:132668988-132669010 GTGTCAACACACTGTGAAAAAGG - Intronic
1091104967 11:132909924-132909946 GTGTTATTACATTTATAAAATGG + Intronic
1092056026 12:5508631-5508653 GTGGTAACACAGGGAGAAGATGG + Intronic
1092349498 12:7744591-7744613 ATGTTTATACAGTGATACAATGG - Intronic
1093193071 12:16097529-16097551 GTGAGGTTACAGTGAGAAAATGG - Intergenic
1093543354 12:20315429-20315451 GTATAAATAAAGTGTGAAAAAGG - Intergenic
1093993364 12:25614884-25614906 GTGTGAAAACAGGGAGAAGATGG - Intronic
1094366962 12:29694151-29694173 GTTATAGTACAGTGTGAAAAAGG - Intronic
1097073681 12:56376273-56376295 GTGAGGACACAGTGAGAAAATGG - Intergenic
1097651929 12:62309359-62309381 ATGTCAATACAGTAAGAAATAGG + Intronic
1097891620 12:64782277-64782299 TTTTTAATACAGTGAGGAGATGG - Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1099137508 12:78925789-78925811 GGTTTCATACATTGAGAAAAAGG - Intronic
1100590667 12:96025300-96025322 GTGTTAAACCAGAGAGAAATGGG - Intronic
1100959435 12:99946054-99946076 GTGTTAACTCACTGAGAAATTGG + Intronic
1101051810 12:100871726-100871748 GTGAGAATGCAGTGAGAAGATGG - Intronic
1101583663 12:106066372-106066394 TTGCTAATACAAGGAGAAAAGGG + Exonic
1104838058 12:131804895-131804917 GTGCTAATACAGTGATATAGTGG - Intergenic
1105266057 13:18816578-18816600 GTGTTAACACAGAAAGGAAATGG - Intergenic
1105713266 13:23033876-23033898 GTGTTACTACAGGGATGAAATGG + Intergenic
1106189632 13:27439789-27439811 GTGGAAAAACAGTGAAAAAAAGG + Intronic
1107264958 13:38542591-38542613 GTGTGAATATAGAGGGAAAATGG - Intergenic
1107285468 13:38785412-38785434 GTGTGGATACAGAGAGCAAACGG + Intronic
1107557543 13:41530347-41530369 GTGAGAATACAGTAAGAAGATGG + Intergenic
1108056852 13:46493837-46493859 GTGTTAATACAAAGATAAAAAGG + Intergenic
1108139508 13:47404884-47404906 GTGTAAACACAGAGAGGAAATGG - Intergenic
1108309835 13:49177293-49177315 GTATAAATACAGTTAGAGAAAGG - Intronic
1108770642 13:53696505-53696527 GTGTTACTCCAGTGAAAACATGG + Intergenic
1109049100 13:57455031-57455053 ATTTTAATACAGGGAGAAAAAGG + Intergenic
1109470367 13:62796642-62796664 GTGAGGATACAGGGAGAAAATGG - Intergenic
1109505678 13:63299715-63299737 GTGAGAATACAATGAGAAGATGG + Intergenic
1110008884 13:70306457-70306479 GGGTAAATACAGGGAGAAATTGG - Intergenic
1111189030 13:84784501-84784523 GTCTTACTACATTGAGAAGAAGG + Intergenic
1111208370 13:85042271-85042293 GACTTAATACACTGAGAAACTGG + Intergenic
1111638402 13:90934970-90934992 GTGTTAAGCCACTGAGAATAGGG - Intergenic
1112424803 13:99288221-99288243 GTTTTAACACTCTGAGAAAATGG + Intronic
1113321979 13:109242808-109242830 TTTATAATACAGTGTGAAAACGG + Intergenic
1115977029 14:39008138-39008160 GTGTGGTTAGAGTGAGAAAAAGG - Intergenic
1116161405 14:41270446-41270468 CTCTGTATACAGTGAGAAAATGG - Intergenic
1117250856 14:53935941-53935963 GTGTGGATACAATGAGAAGATGG - Intergenic
1118042817 14:61935899-61935921 GTTTTAATACATTGAGTAAAGGG + Intergenic
1118427390 14:65681092-65681114 GTTTAAATACAGTGAAAACATGG - Intronic
1120053416 14:79894987-79895009 GTGTTATTAAAGCTAGAAAAAGG - Intergenic
1120321463 14:82967100-82967122 GTTTTAATTCAGTAAGAAACTGG - Intergenic
1120500348 14:85289390-85289412 GTGAAATTACAGTGAGAAGATGG - Intergenic
1121321966 14:92996977-92996999 GTGTAAACAGACTGAGAAAATGG + Intronic
1202832452 14_GL000009v2_random:51519-51541 GTGTTAACACAGAAAGGAAATGG + Intergenic
1125074444 15:35596877-35596899 CTCTTGATACAGTGGGAAAAGGG - Intergenic
1126385217 15:48087297-48087319 AAGGTAATACAGTAAGAAAAAGG - Intergenic
1127249687 15:57219569-57219591 GTATTACTACAATGGGAAAACGG + Intronic
1128706696 15:69842106-69842128 GTGAAGATACAGTGAGAAGATGG + Intergenic
1129246013 15:74279210-74279232 GTGTTATTACAGGGAAAAATGGG + Intronic
1129897443 15:79118873-79118895 GTAATAATACACTGAGGAAAGGG + Intergenic
1130032139 15:80325782-80325804 GATTCAATACAGTGAGAAAAGGG - Intergenic
1130125985 15:81094509-81094531 AGGTTAATGCAGTGAGAAGAGGG + Intronic
1134101348 16:11454090-11454112 CTTCTAAGACAGTGAGAAAAGGG + Intronic
1134296305 16:12949111-12949133 TTCTTAATACAGGGAGAGAAGGG - Intronic
1134382608 16:13741921-13741943 GTGGTAACACAGTGAGAAGGTGG - Intergenic
1135149136 16:19990137-19990159 TTGTTAATACACTGAGGTAATGG - Intergenic
1135290291 16:21230682-21230704 TTATGAATACTGTGAGAAAATGG - Intergenic
1135933689 16:26761127-26761149 GTGTGAATAAAGCAAGAAAAAGG - Intergenic
1136015732 16:27399572-27399594 GGCGTAATACAGTGAGCAAATGG - Intergenic
1136528216 16:30847011-30847033 GAGTTATTACAAAGAGAAAATGG + Intronic
1137264287 16:46856094-46856116 GAGTTAATACAATGAGACTAAGG - Intergenic
1140425054 16:74854045-74854067 TGTTTATTACAGTGAGAAAAAGG - Intergenic
1141300595 16:82812083-82812105 GTGTGAATACATAGAGACAAAGG - Intronic
1141912206 16:87067735-87067757 GGGGTAACACAGTCAGAAAAAGG - Intergenic
1145070523 17:19801723-19801745 GATTTATTACAGTGAAAAAAAGG + Intronic
1147564911 17:41530018-41530040 GTGATAATACACAGAGAAGAGGG - Intergenic
1147704688 17:42418147-42418169 ATGTTCACACAGTGAGGAAATGG + Intronic
1148969577 17:51468095-51468117 GTGTGAGTTCAGTGAGAAGACGG - Intergenic
1149017308 17:51923391-51923413 GTTTTAATAGAGTGAGAAGTTGG - Intronic
1149321966 17:55490746-55490768 TTATTTATAAAGTGAGAAAAAGG + Intergenic
1150977131 17:70100679-70100701 GTGTTAAAATAGTGAGACACAGG + Exonic
1151106648 17:71623507-71623529 GTGATGATACAATGAGAAGATGG - Intergenic
1153090244 18:1334821-1334843 GTGATGACACAGTGAGAAGATGG - Intergenic
1153324300 18:3802348-3802370 GTTTTAATAAAGTGAGCAATAGG - Intronic
1154422348 18:14244908-14244930 GTGTTAACACAGAAAGGAAATGG + Intergenic
1155224072 18:23713146-23713168 GTATTAATTCAGTAAGTAAATGG - Intronic
1156196290 18:34777486-34777508 GAACTAATACAGTGTGAAAATGG - Intronic
1157897482 18:51482833-51482855 GTGACAACACAGTGAGAAGATGG + Intergenic
1158870618 18:61683977-61683999 GTGAGAATACAGTGAGAAGGTGG + Intergenic
1159376331 18:67598287-67598309 GTGAGAATACAGTGGGAAGACGG - Intergenic
1160258698 18:77270087-77270109 GTGTGTTTACAATGAGAAAATGG + Exonic
1162411390 19:10507948-10507970 GTGGGAACACAGTGAGAAAGCGG + Intergenic
1165396322 19:35565682-35565704 GTGTAAATACAGTGGGGTAAAGG - Intergenic
1167339913 19:48909151-48909173 GTGAAAATGCAGTGAGAAGACGG - Intronic
1202640233 1_KI270706v1_random:76215-76237 GTGTTAACACAGAAAGGAAATGG - Intergenic
924981328 2:224377-224399 GTGCTAAAACACAGAGAAAATGG + Intronic
925815496 2:7744021-7744043 GTGTTAGAACTTTGAGAAAAAGG + Intergenic
927082306 2:19642647-19642669 ATGTCCTTACAGTGAGAAAAGGG + Intergenic
927437486 2:23080871-23080893 ATCTTAAAACAGTGAAAAAAAGG - Intergenic
927525145 2:23733110-23733132 ATGTTCATACATTGAGAGAATGG - Intergenic
929039995 2:37735348-37735370 GTGTTTATACAGTTTGATAAAGG + Intronic
929497012 2:42453880-42453902 TTTTTAATATAGTGAGATAAAGG + Intronic
929536138 2:42785360-42785382 CTGTTAATAAAATGGGAAAATGG + Intronic
930283160 2:49395664-49395686 GTGTTTGGACAGTGAGAAAAGGG + Intergenic
930340001 2:50100307-50100329 GTGGTCGTAAAGTGAGAAAAAGG + Intronic
931386300 2:61800708-61800730 GAGTAAATACAATGGGAAAATGG + Intergenic
931583503 2:63802944-63802966 GTGTTATTACAATGTAAAAAGGG - Intronic
933146195 2:78856254-78856276 GTGATAAAATAGTGAGTAAATGG + Intergenic
933264462 2:80167536-80167558 GAGTAAATACAGTGAAAATATGG + Intronic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
935349400 2:102140823-102140845 GTGGTAATAAGGTGAGAAAGAGG + Intronic
935827623 2:106967357-106967379 ATAATAAAACAGTGAGAAAAGGG - Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
937714134 2:125012256-125012278 GTGAGAATACAGTGAGAAGTTGG + Intergenic
938948726 2:136238052-136238074 GTTATAATACAGTAAGCAAAGGG - Intergenic
938990021 2:136618170-136618192 GTGTATGTACAGTGAGGAAAAGG - Intergenic
939162156 2:138603611-138603633 GTGAGAACACAGTGAGAATATGG - Intergenic
939396745 2:141640484-141640506 CTTTTAATACAGTCAGAAAGAGG + Intronic
939796371 2:146649815-146649837 TTGTTTATAGAGAGAGAAAAAGG + Intergenic
940001578 2:148971763-148971785 GTGGTTATGCAGTGAGATAATGG + Intronic
940117107 2:150220823-150220845 CTGAGAATACAGTGAGAAGATGG + Intergenic
940433161 2:153618401-153618423 GTCTTAATACATTAAAAAAAAGG - Intergenic
941319028 2:164031570-164031592 GTGTTAAGCCACTGAGAAATTGG - Intergenic
941638064 2:167957470-167957492 GTGATAACACAAGGAGAAAATGG - Intronic
942132219 2:172891712-172891734 GTGTAAAAACAGTGACAGAATGG + Intronic
942896749 2:181065969-181065991 GTCTTAAGAGAGTGAGATAATGG + Intronic
943542938 2:189240320-189240342 GTGAGAATACAGTGAGACAGTGG - Intergenic
944029451 2:195216600-195216622 GTGAGTATACAGTGAGATAATGG - Intergenic
945192248 2:207200981-207201003 GTTTTAATTCAGTGACACAATGG + Intergenic
945279906 2:208026191-208026213 GTACTTATAAAGTGAGAAAATGG - Intergenic
945282302 2:208047381-208047403 GTGAGATTACAGTGAGAAGACGG + Intergenic
945544354 2:211131443-211131465 GTCTTACAACATTGAGAAAATGG + Intergenic
945763377 2:213943007-213943029 GTGAAAATACAATGAGAAGATGG + Intronic
946131574 2:217610829-217610851 GTGAAAATACTTTGAGAAAACGG + Intronic
946150001 2:217758024-217758046 GTGGGGATACAGTGAGAAGATGG + Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
1169558391 20:6772349-6772371 GTCTTAATGCAGTTAGATAATGG + Intronic
1170111872 20:12813312-12813334 TTTTTAATACACTGAGAAATAGG - Intergenic
1170315327 20:15035059-15035081 GTGGTAAAAGAGTGAGAAAATGG - Intronic
1170477573 20:16730708-16730730 CTGTAAATACTGTGAGATAAAGG + Intronic
1171369005 20:24648458-24648480 GTGATGATACAGTGAGACAAAGG - Intronic
1171887110 20:30662874-30662896 GTGTTAACACAGAAAGGAAATGG - Intergenic
1174140564 20:48410547-48410569 GAATTAATACACTGAGGAAATGG + Intergenic
1174661799 20:52220181-52220203 GTTTTATAACAGTGTGAAAATGG - Intergenic
1174669534 20:52293510-52293532 GTGTTAAGGGAGAGAGAAAACGG - Intergenic
1175055947 20:56198408-56198430 GTGTAAATATAGAGAGAAAGTGG + Intergenic
1175261620 20:57678043-57678065 GGGTGGATACAGTTAGAAAAGGG + Intronic
1175793897 20:61759301-61759323 TTGTGAAAACAGTGAGAAAGGGG + Intronic
1176648559 21:9373801-9373823 GTGTTAACACAGAAAGGAAATGG - Intergenic
1176851125 21:13915041-13915063 GTGTTAACACAGAAAGGAAATGG - Intergenic
1176933144 21:14837671-14837693 ATGTTAACACAATCAGAAAAAGG - Intergenic
1177192222 21:17864621-17864643 GAGTCAATACAGTGGGAAAATGG + Intergenic
1178753884 21:35329218-35329240 GTTTAACTACAGTGAGAAAAAGG - Intronic
1180361710 22:11905681-11905703 GTGTTAACACAGAAAGGAAATGG + Intergenic
1181905857 22:26195633-26195655 CTGATGATACAGTGACAAAATGG + Intronic
1182160011 22:28112240-28112262 GTATTTAGAGAGTGAGAAAAAGG + Intronic
949270333 3:2209096-2209118 GTGTTAATACACTGAGATTTGGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951098220 3:18656281-18656303 CTGTCAATACTGTGAGAAAAGGG - Intergenic
952776331 3:37050055-37050077 GTTTTCATTCAGGGAGAAAATGG - Intronic
953597974 3:44336199-44336221 GTGTTAATACAGCTAGAAGGTGG + Intergenic
953616533 3:44495801-44495823 GAGTTAATATAGTTAGGAAATGG + Intergenic
955579052 3:60399292-60399314 GGGTTAAGAAAGGGAGAAAATGG - Intronic
956069716 3:65435017-65435039 ATGAGGATACAGTGAGAAAATGG + Intronic
956118261 3:65940436-65940458 GTGAAGATACAGTGAGAAGATGG - Intronic
956212464 3:66815630-66815652 ATGGTGATACAGTCAGAAAAGGG + Intergenic
958551210 3:95615837-95615859 CTGTTAACACAGTGGGACAAAGG + Intergenic
958822800 3:98995044-98995066 ATGTAAATACAGGGAGAAAAAGG + Intergenic
958855024 3:99374869-99374891 TTGTTTATTCAGTGAGAAATTGG + Intergenic
959978727 3:112490586-112490608 GTGTTTACCCAGGGAGAAAATGG - Intronic
960776126 3:121256114-121256136 GTGTAAATAAAATGGGAAAATGG + Intronic
961321533 3:126080040-126080062 TTTTTAATATAGTGAGAAATAGG - Intronic
962026034 3:131548553-131548575 ATGTTAACACAGTCAGAGAATGG + Intronic
963659670 3:148109265-148109287 GTGTTAATACAGAGAGCAGCTGG + Intergenic
963829245 3:149989675-149989697 GTATTACTACAGAGAGAAGATGG - Intronic
963843719 3:150133674-150133696 GGGTTAATACAGTCAGTCAAGGG + Intergenic
964011230 3:151894375-151894397 GTGACAACACAGTGAGAAAATGG + Intergenic
964045249 3:152316099-152316121 GTATTAATACAGGGAGAGAGTGG - Intronic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
965166865 3:165205196-165205218 GTCTTAAAACACTGAGAACAGGG - Intergenic
965276295 3:166686959-166686981 CTGGTTATACACTGAGAAAATGG - Intergenic
965565057 3:170106890-170106912 GTGTGAATTCTGTGGGAAAATGG - Exonic
966069059 3:175852454-175852476 GTGTTAATACTGGGGGAAAGTGG - Intergenic
966077224 3:175951972-175951994 GTGTTAATAAAGTGAAAAGTTGG - Intergenic
966265471 3:178036655-178036677 GTGTTGATACAGAGAAGAAAAGG + Intergenic
967649560 3:191969484-191969506 GTTTTAATACTGTTTGAAAATGG - Intergenic
1202738322 3_GL000221v1_random:31185-31207 GTGTTAACACAGAAAGGAAATGG + Intergenic
970007059 4:11421529-11421551 GTTAAAATACAGTGAGAGAAAGG - Intronic
971184832 4:24364289-24364311 GTATTAATTCATAGAGAAAAGGG - Intergenic
973370468 4:49242563-49242585 GTGTTAACACAGAAAGGAAATGG - Intergenic
973390556 4:49552853-49552875 GTGTTAACACAGAAAGGAAATGG + Intergenic
974091728 4:57318048-57318070 GTTTTAAAACAGTGACAAAAGGG + Intergenic
974200884 4:58638912-58638934 GTGATAATAAAGGAAGAAAAAGG + Intergenic
974331253 4:60481886-60481908 ATGTAAATAAAGAGAGAAAATGG - Intergenic
974825324 4:67120795-67120817 CTGTTTATTGAGTGAGAAAAGGG + Intergenic
975225487 4:71866411-71866433 GTGACAATACAGTGAGAAGATGG + Intergenic
975682845 4:76894355-76894377 GAGTTCATGGAGTGAGAAAATGG - Intergenic
975914383 4:79306380-79306402 GTGAAGATACAGGGAGAAAATGG - Intronic
976105072 4:81607660-81607682 ATGTAATTACAGGGAGAAAATGG - Intronic
976318547 4:83685559-83685581 GTGCTGACACAGTGAGGAAATGG + Intergenic
976504041 4:85825821-85825843 GTTTTTATATAGTGAGAATAGGG - Intronic
979754138 4:124318587-124318609 CTGTATATGCAGTGAGAAAAGGG - Intergenic
979797713 4:124867711-124867733 GTGTGGATACAGTGGAAAAAGGG + Intergenic
980069262 4:128226115-128226137 GTGTAAATGCACTGACAAAAGGG + Intergenic
980565369 4:134532557-134532579 GTCTTAATCCATTGAGAAAGTGG - Intergenic
980622944 4:135333181-135333203 GTGTTAAAAGGGTTAGAAAATGG + Intergenic
981178712 4:141714155-141714177 ATTTTAATTCACTGAGAAAATGG + Intronic
981332611 4:143529867-143529889 GTGTCAATGTAGTGAGAAACAGG - Intronic
982333358 4:154207031-154207053 GTGTGCAGACAGTCAGAAAATGG - Intergenic
982338760 4:154271174-154271196 GTATAAATACAGTGTGAAGAAGG + Intronic
983125020 4:163940095-163940117 GTGATAATACAATGATAAGATGG + Intronic
984963579 4:185121518-185121540 GTGTTGATACAGTTTGAATATGG + Intergenic
985031004 4:185789851-185789873 GCACTAAAACAGTGAGAAAATGG - Intronic
985332453 4:188853795-188853817 GTTTTATGTCAGTGAGAAAAAGG - Intergenic
1202767594 4_GL000008v2_random:162073-162095 GTGTTAACACAGAAAGGAAATGG - Intergenic
986042481 5:4006860-4006882 TTGTTCATAGAGTGAAAAAAAGG - Intergenic
986543200 5:8869045-8869067 GTGATGATACACTGAGAAGATGG - Intergenic
987069149 5:14319642-14319664 CTGTAAGTACATTGAGAAAAAGG + Intronic
987687354 5:21222010-21222032 GTGTTATTACAATTTGAAAAGGG - Intergenic
987938938 5:24507092-24507114 ATGTTAATACAGTAATCAAAGGG - Intronic
988123254 5:26994590-26994612 GTGAAGATACAATGAGAAAATGG + Intronic
989800002 5:45525989-45526011 GTGAGAATACAGTGAGAAGTTGG + Intronic
990325287 5:54669588-54669610 ATGAAAATACACTGAGAAAAAGG + Intergenic
990458031 5:56006707-56006729 GTCTTTATAAAGTTAGAAAAAGG - Intergenic
991250079 5:64550329-64550351 GTGAGAATACAGTGAGATAGTGG - Intronic
992522965 5:77575271-77575293 GAGTTGATATAGTGAGAAATAGG + Intronic
992987686 5:82250475-82250497 GTGGGGATACAGTGAGAAGATGG - Intronic
993314847 5:86389243-86389265 GTATTTATACTGTGAGAATAAGG - Intergenic
994901346 5:105774487-105774509 GTACTGATAAAGTGAGAAAAGGG + Intergenic
995012036 5:107267091-107267113 GTGTTATTACAATAAGACAAAGG - Intergenic
995949545 5:117693795-117693817 GTATTAATCCAGTGAGCAATTGG - Intergenic
995974141 5:118010230-118010252 GTTCTAATACAATGGGAAAAAGG + Intergenic
996473728 5:123890618-123890640 GTGTTTATACAATGATAAAAGGG + Intergenic
996585110 5:125078977-125078999 GTTTTAATACAAAGAGAATAAGG - Intergenic
997104658 5:131005219-131005241 GAGTTACTTCAGTTAGAAAATGG - Intergenic
997619836 5:135279939-135279961 GTCTTAATAAACTCAGAAAATGG + Intronic
998030264 5:138860767-138860789 GTTTTAATACGGTAATAAAATGG + Intronic
999846617 5:155488399-155488421 GTGATTATACAGTGAAAACATGG + Intergenic
1000037658 5:157460995-157461017 AAGGTAATACAGTGAGGAAATGG + Intronic
1001457112 5:171872328-171872350 GTGTTGAGACAGTGGGGAAATGG + Intronic
1001713920 5:173799213-173799235 GTGAGGATCCAGTGAGAAAATGG + Intergenic
1004018924 6:11758797-11758819 GTGTTGGTACATTGAGAAAGTGG + Intronic
1004761179 6:18668188-18668210 GTTTTAATAAACTGAGAAAGAGG - Intergenic
1005699768 6:28388688-28388710 GTGGTGAGACAGTGACAAAAGGG - Intronic
1009329500 6:62398876-62398898 GTTTTTATACAATGATAAAAGGG - Intergenic
1009854040 6:69237469-69237491 ATGTTAATACAGTGATGACAAGG - Intronic
1011125991 6:84008474-84008496 GTGTTATTCGAGTCAGAAAAGGG - Intergenic
1011153442 6:84300987-84301009 ATATAAATACACTGAGAAAAGGG + Intergenic
1011780090 6:90778853-90778875 GTGTTAAAAAACTCAGAAAAGGG + Intergenic
1011950435 6:92958149-92958171 ATGTTAACATAGAGAGAAAATGG + Intergenic
1012003482 6:93684081-93684103 GTGTTCCTACAGGGAGATAAAGG - Intergenic
1012180177 6:96143232-96143254 GTGATGACACAGTGAGAAGATGG + Intronic
1012221326 6:96652682-96652704 GTGTAAATCCACAGAGAAAAAGG - Intergenic
1012351928 6:98262249-98262271 GTGCTCACACACTGAGAAAAGGG + Intergenic
1012357483 6:98333619-98333641 GTGCAATTACAGTGAGAAGATGG - Intergenic
1013429778 6:110045114-110045136 GTGTTAATATAGTGTTATAAGGG + Intergenic
1013442160 6:110181218-110181240 GTGTTAATACAGTGAGAAAAAGG + Intronic
1013770983 6:113628087-113628109 GGGCTATTACAGGGAGAAAATGG + Intergenic
1013799501 6:113925491-113925513 GTGAAGATACAGTGAGAAGATGG - Intergenic
1014348124 6:120301796-120301818 GGGCTAATACATTGTGAAAACGG - Intergenic
1014671264 6:124307045-124307067 CTGTTACCACAGTGAGGAAAAGG + Intronic
1015504989 6:133975208-133975230 ATGATACTACAGTGAAAAAAGGG + Intronic
1016540385 6:145157883-145157905 GTGAGGATACAGTGAGAAGATGG + Intergenic
1016625744 6:146165988-146166010 GTATTAAAACATTGAGGAAAAGG + Intronic
1016721227 6:147301154-147301176 GTGTTAGTATATGGAGAAAAGGG + Intronic
1016732406 6:147440735-147440757 GTGAGATTAGAGTGAGAAAACGG - Intergenic
1017016060 6:150100429-150100451 GGGATAATACAGGGAGAAACAGG - Intergenic
1017031423 6:150226471-150226493 GTGCAAAGATAGTGAGAAAAAGG - Intronic
1018035102 6:159875039-159875061 GTGATGATACAGGGAGAAAATGG + Intergenic
1018415659 6:163600270-163600292 CTGTTATTACACTGAGAGAAGGG + Intergenic
1019199750 6:170304999-170305021 GTGAGGATACAGTGAGAAGATGG - Intronic
1019762177 7:2821378-2821400 TCGTAAATACTGTGAGAAAATGG + Intronic
1020740752 7:12013975-12013997 ATGTTCACACAGTGACAAAATGG - Intergenic
1020789898 7:12614592-12614614 GTCTTACTACAGTGAGCAACTGG + Intronic
1022155064 7:27652679-27652701 GTGAGGATACAGTGAGAAAATGG - Intronic
1022327219 7:29343394-29343416 GTGGCAATACAGGGAGACAAGGG - Intronic
1023678861 7:42662554-42662576 GAGTAAATACAGTGAGTCAAAGG + Intergenic
1024767460 7:52676737-52676759 TTGAGAACACAGTGAGAAAATGG - Intergenic
1027905010 7:84167645-84167667 GTGTTAATAAAATAAGACAAAGG + Intronic
1028288535 7:89035404-89035426 GTGTTATTAGAATAAGAAAATGG + Intronic
1028692366 7:93667862-93667884 TTGATAACACAGTGAGAAAGTGG - Intronic
1030269552 7:107655713-107655735 TTGTTAATGGAGGGAGAAAAGGG - Intergenic
1030922216 7:115405634-115405656 AGTTTAATACAGTGTGAAAATGG + Intergenic
1030923787 7:115426089-115426111 GTGTCAAGTTAGTGAGAAAAAGG - Intergenic
1031772095 7:125857048-125857070 CTGTTACTACTATGAGAAAAGGG - Intergenic
1032912257 7:136446692-136446714 CTGTTAATAGAGTGAAAAATAGG + Intergenic
1033519387 7:142145599-142145621 GTGTTAATCCACTGAGATATTGG - Intronic
1034592072 7:152149443-152149465 GTTTTAATATAGTTAGAAAGGGG - Intronic
1034699768 7:153085761-153085783 GTGCTAAGAAAATGAGAAAAGGG + Intergenic
1034923700 7:155103868-155103890 GTGTCCATGCAGTGAGAACATGG + Intergenic
1035787451 8:2272834-2272856 GCGTGAAAACAGCGAGAAAATGG + Intergenic
1035805356 8:2448882-2448904 GCGTGAAAACAGCGAGAAAATGG - Intergenic
1037124625 8:15332155-15332177 GTTTTGATACTTTGAGAAAATGG + Intergenic
1039015861 8:33147833-33147855 GTGTTGATCCTGTGAAAAAATGG - Intergenic
1039170232 8:34736826-34736848 GTGTCATTACAGTTATAAAAAGG + Intergenic
1039307454 8:36278164-36278186 GTGTTATTAAAGTGAGAAAAAGG + Intergenic
1039334986 8:36578986-36579008 GTGTTAATTCTCTTAGAAAAGGG - Intergenic
1039856070 8:41415458-41415480 CTGTTAATCCAGAGACAAAATGG + Intergenic
1041093131 8:54322667-54322689 ATGTTAATACATGCAGAAAAGGG + Intergenic
1041977884 8:63819750-63819772 GTGTGAACACAGTGAGAAGGTGG + Intergenic
1042134317 8:65618629-65618651 GTGTTGAGACTGTTAGAAAATGG - Intronic
1042168102 8:65966063-65966085 TTGCTACTACAGTGACAAAAAGG - Intergenic
1042424515 8:68631932-68631954 TTTTTTATACAGTGTGAAAAAGG + Intronic
1042943904 8:74136012-74136034 GAGTTAATCCAGTGAGACACTGG - Intergenic
1042951644 8:74206211-74206233 CTGATAATTCAATGAGAAAATGG - Intergenic
1043243543 8:77968327-77968349 GTGTTAATAATGAGAGAAATAGG + Intergenic
1043629135 8:82306612-82306634 CTGTTATTACAGGTAGAAAATGG - Intergenic
1044344442 8:91088957-91088979 GTGTTAATTCACTTAGATAATGG + Intergenic
1044536757 8:93365756-93365778 GAGTTAACACAATGAAAAAATGG - Intergenic
1045192081 8:99893268-99893290 GTGTTTCTCCCGTGAGAAAAGGG - Intronic
1045704601 8:104907136-104907158 GTGTTAATATAGTCAGGAATTGG + Intronic
1045993544 8:108338185-108338207 GGATTAATACAGTGACTAAAAGG - Intronic
1046130549 8:109962706-109962728 TTGATAATACAGTAAGAAGAGGG + Intergenic
1046151605 8:110234037-110234059 GTGTTAGTACAATTAGAATATGG - Intergenic
1046186096 8:110721545-110721567 ATGAAGATACAGTGAGAAAACGG - Intergenic
1046295494 8:112214369-112214391 GAGATAAGACAGTGAGACAAAGG - Intergenic
1046502965 8:115102075-115102097 GTGTTAGCACAGGAAGAAAATGG + Intergenic
1046673305 8:117081373-117081395 GTGAGAACACAGTGAGAAGACGG - Intronic
1047028301 8:120848729-120848751 GTGTTGATTCAGTGAGGAGAAGG + Intergenic
1048489703 8:134881172-134881194 GTGAGAATACAGGGAGAAGATGG + Intergenic
1048642681 8:136381907-136381929 GGGTTAATACAATGAGCAATGGG - Intergenic
1049701797 8:144018322-144018344 GTGAAAAGTCAGTGAGAAAATGG + Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1050774938 9:9248040-9248062 GTGTTAAGTCATTGAGTAAACGG + Intronic
1051178970 9:14390734-14390756 GTGAGAACACAGTGAGAAGATGG + Intronic
1051777282 9:20649568-20649590 TTGTTAATTCTGTGAGATAATGG - Intergenic
1052876311 9:33569017-33569039 GTGTTAACACAGAAAGGAAATGG + Intronic
1053109414 9:35444611-35444633 CTGTAACTACAGTGAGAAATAGG - Intergenic
1053499704 9:38575333-38575355 GTGTTAACACAGAAAGGAAATGG - Intronic
1053661415 9:40284734-40284756 GTGTTAACACAGAAAGGAAATGG + Intronic
1053911792 9:42914077-42914099 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054373537 9:64430952-64430974 GTGTTAACACAGAAAGGAAATGG + Intergenic
1054523194 9:66091550-66091572 GTGTTAACACAGAAAGGAAATGG - Intergenic
1055184883 9:73439104-73439126 GTGAAAATATAATGAGAAAAAGG + Intergenic
1056011111 9:82331598-82331620 ATGTTTATTCAGTAAGAAAAGGG - Intergenic
1059997698 9:119928596-119928618 GTGTGAATTAAGTGAGGAAATGG - Intergenic
1203692007 Un_GL000214v1:51026-51048 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203707052 Un_KI270742v1:61630-61652 GTGTTAACACAGAAAGGAAATGG + Intergenic
1203548350 Un_KI270743v1:146945-146967 GTGTTAACACAGAAAGGAAATGG - Intergenic
1203644288 Un_KI270751v1:53165-53187 GTGTTAACACAGAAAGGAAATGG + Intergenic
1185995800 X:4947311-4947333 TTGTCAAGACAGTGAGCAAAAGG - Intergenic
1186875730 X:13816117-13816139 GTGTTTTTGCAGTAAGAAAATGG - Intronic
1187092163 X:16107916-16107938 GTGAAATTACAGTGAGAAAATGG + Intergenic
1187470059 X:19561647-19561669 GTCATAATGCACTGAGAAAAAGG + Intronic
1188615047 X:32147841-32147863 GAGTGTATACAGTTAGAAAATGG - Intronic
1188786102 X:34348545-34348567 GTATTACTACAATGATAAAATGG + Intergenic
1188875952 X:35430409-35430431 CTGTTAACACAGGAAGAAAAGGG + Intergenic
1188918465 X:35941603-35941625 TGATTAATACAGTCAGAAAATGG + Intronic
1193129763 X:77907376-77907398 GTGTTAATTCAGTGACAAAAAGG - Intergenic
1193956669 X:87872231-87872253 ATATAAATAAAGTGAGAAAAAGG - Intergenic
1196037508 X:111162191-111162213 ATGTTAATACAGTGGTAAAATGG - Intronic
1197866878 X:131028422-131028444 GTCTTATTCCAGTAAGAAAAAGG + Intergenic
1198091751 X:133337813-133337835 ATGTTAATACCATGTGAAAATGG - Intronic
1198891803 X:141404686-141404708 GGATTAATACTGTGACAAAAGGG - Intergenic
1200395185 X:155981963-155981985 GAGTTCATACAGTTAGAAAGTGG + Intergenic
1202302186 Y:23428538-23428560 ATCTCACTACAGTGAGAAAAGGG - Intergenic
1202568625 Y:26242060-26242082 ATCTCACTACAGTGAGAAAAGGG + Intergenic