ID: 1013443895

View in Genome Browser
Species Human (GRCh38)
Location 6:110201330-110201352
Sequence ACATATAGATTTGAGTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013443893_1013443895 13 Left 1013443893 6:110201294-110201316 CCACATGGGGCTACTGAGCTCTT 0: 1
1: 6
2: 101
3: 407
4: 928
Right 1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG 0: 1
1: 0
2: 2
3: 32
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013443895 Original CRISPR ACATATAGATTTGAGTGAGA GGG Intronic
900769077 1:4526470-4526492 ACAAATAGATTTTAGTGAGTAGG + Intergenic
900838654 1:5028368-5028390 ACATATATATTTGACTGTGTCGG + Intergenic
901778063 1:11574278-11574300 ACATATAAATTTGGGGGACAGGG - Intergenic
904681882 1:32234915-32234937 ACATAGAGAATAGGGTGAGATGG - Intergenic
906038921 1:42771554-42771576 AAATATGGATTAGACTGAGAAGG + Intronic
907174273 1:52503486-52503508 AGACATAGTTTTGAGTGAGAAGG - Intronic
907957552 1:59244545-59244567 ACATATAAATTTGGGTGTGGGGG + Intergenic
908442877 1:64172241-64172263 TCATTTAGATGTGAGTCAGATGG - Intronic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
910572762 1:88724019-88724041 ATTTAGAGATTTGAGAGAGAAGG + Intronic
911472873 1:98339965-98339987 ACAAATAGAAATGAGAGAGAAGG - Intergenic
911500404 1:98678906-98678928 TAATATAGTTTGGAGTGAGAGGG + Intronic
912991974 1:114496983-114497005 ACATTTTGTTTTGAGTTAGATGG - Intronic
913357539 1:117939874-117939896 ACATATATATTTGAGGGGAAAGG - Intronic
915821107 1:159024658-159024680 ACATAAATATTTGTGTGAAAAGG + Intronic
916900037 1:169212400-169212422 ACAAATAAATTTCAGTGAGTAGG - Intronic
917891226 1:179440084-179440106 AAATATAGTTTTGATTGAGGTGG + Intronic
917917802 1:179721965-179721987 ACATCTGGGTTTGGGTGAGATGG + Intergenic
918683476 1:187385226-187385248 ACATATAGATTTGAAAGCTAAGG + Intergenic
921048883 1:211496737-211496759 ACAAATAAATTTTAGTGAGTAGG - Intergenic
921262834 1:213399044-213399066 ACATATAGATTTAAGTTAACAGG + Intergenic
921419713 1:214932244-214932266 ACATAGAGATTTGAGGGAGATGG - Intergenic
922138382 1:222855249-222855271 ACAAAAAGGTTTGTGTGAGAGGG - Intergenic
922292848 1:224223013-224223035 CCAAATAGATTTGGGTGAGATGG - Intergenic
923940955 1:238826359-238826381 ACATATAAATTTTAATGAAATGG - Intergenic
924718844 1:246604611-246604633 ATATATATATTTGTGGGAGAAGG - Intronic
1063273170 10:4534885-4534907 ATATATATATATGAGTGAAACGG + Intergenic
1063825648 10:9895036-9895058 ACATACATATCTGTGTGAGAAGG + Intergenic
1063866467 10:10370361-10370383 ACAAATAAATTTCAGTGAGTAGG + Intergenic
1064594234 10:16927213-16927235 ATATATACATGAGAGTGAGAGGG + Intronic
1065923526 10:30415126-30415148 ACATATATATTTTAGAGACAGGG + Intergenic
1067312616 10:45128387-45128409 ATATATACATGAGAGTGAGAGGG - Intergenic
1067359255 10:45562143-45562165 ACATAAAGAATAGACTGAGATGG + Intronic
1069337432 10:67369087-67369109 ACATACATATTTTAGTGACAGGG - Intronic
1070000094 10:72369883-72369905 ACATATATATTTTTTTGAGACGG + Intronic
1072405316 10:95146926-95146948 AGATTTGGATTTGAGAGAGAAGG - Intergenic
1073896995 10:108173255-108173277 ACATATTTTTTTAAGTGAGAAGG - Intergenic
1074427754 10:113367226-113367248 ATATATAAATTTGTGGGAGATGG + Intergenic
1078344925 11:10539690-10539712 ACATATATATTAGAGAGAGAAGG + Intronic
1079543994 11:21610816-21610838 ACACATATATTTAAGAGAGAGGG - Intergenic
1079850300 11:25524917-25524939 ACATATTAATTTGGGTGGGAGGG + Intergenic
1080778281 11:35406688-35406710 ACAGATAGAATTTACTGAGATGG + Intronic
1081458987 11:43253494-43253516 ACATAAAGATGTGAGAGACAAGG - Intergenic
1082022408 11:47545830-47545852 ACGTATACATATGAGAGAGAGGG - Intronic
1082059882 11:47850866-47850888 ATATATATATTTTATTGAGATGG + Intergenic
1082169862 11:48990801-48990823 ACATATAGAATGCTGTGAGATGG + Intergenic
1082608035 11:55265971-55265993 ACATATAGAATGCTGTGAGATGG - Intronic
1082864415 11:57885643-57885665 ACGTGGAGATTTGAGTGAGAGGG - Intergenic
1083043125 11:59707440-59707462 ACATATAAATTTGGGTTGGAGGG - Intergenic
1084723747 11:70926819-70926841 ACAAATAAATTTTAGTGAGTAGG + Intronic
1085157128 11:74306039-74306061 ACATATATAAATGTGTGAGAGGG + Intronic
1086695971 11:89845837-89845859 ACATATAGAATGCTGTGAGATGG - Intergenic
1086702571 11:89916612-89916634 ACATATAGAATGCTGTGAGATGG + Intronic
1086703596 11:89927838-89927860 ACATATAGAATGCTGTGAGATGG - Intergenic
1086710184 11:89998646-89998668 ACATATAGAATGCTGTGAGATGG + Intergenic
1089194338 11:116684525-116684547 AGAAATAGATTTGAAAGAGATGG + Intergenic
1090060272 11:123458574-123458596 TCAGATTGATTTTAGTGAGAAGG - Intergenic
1091070791 11:132561051-132561073 AGTTTCAGATTTGAGTGAGAAGG - Intronic
1092004419 12:5057173-5057195 ACATAAAAAGTTGAATGAGAGGG + Intergenic
1092630383 12:10370271-10370293 ACATAAATATTTGTGTGAAAAGG - Intergenic
1094722553 12:33079164-33079186 ACATAGGGATGAGAGTGAGAAGG + Intergenic
1095839507 12:46677178-46677200 ACAGAAAGCATTGAGTGAGAGGG + Intergenic
1095933251 12:47650259-47650281 ATAAATAGAGTTGACTGAGATGG - Intergenic
1096752534 12:53770811-53770833 ATATATATATATGAGAGAGAAGG - Intergenic
1096903424 12:54909283-54909305 AAATATAAATATGAGTCAGAAGG + Intergenic
1097500737 12:60398083-60398105 ATATATAGCTTAGAGAGAGAAGG + Intergenic
1099341106 12:81435928-81435950 ACAAATAGATTTGAATGTTAAGG + Intronic
1099465639 12:82984290-82984312 ACACATAGATATGTGTGAGTGGG + Intronic
1099585988 12:84514413-84514435 AGATATAGATTTGAGGGGAAAGG + Intergenic
1100830484 12:98512477-98512499 ACATATTGATTTTAGAGACAGGG + Intergenic
1103571021 12:121845117-121845139 ATATATATATTTGAGAGACAGGG + Intronic
1106086046 13:26542653-26542675 ACATATAGCTTTGTGTGAATAGG - Intergenic
1107406397 13:40118015-40118037 TTATTTAGATTTGAGTAAGAAGG + Intergenic
1107526251 13:41234667-41234689 ACAAATAAATTTTAGTGAGTAGG - Intronic
1107632910 13:42360879-42360901 ACAGATAAATTTGAGTGAAAGGG - Intergenic
1107780545 13:43897383-43897405 ACTTATACATTTTAGTGAGTAGG - Intergenic
1107826726 13:44335232-44335254 ATATATATATTTTAGTGACAGGG - Intergenic
1108799368 13:54074989-54075011 ACATATTAATGTCAGTGAGATGG + Intergenic
1109543576 13:63812208-63812230 AAATATGGAGATGAGTGAGACGG + Intergenic
1111903083 13:94223824-94223846 ACATATACATTTTAGTGAGTAGG - Intronic
1113011125 13:105767307-105767329 ACATCTAAATTTGAGTAACAGGG + Intergenic
1113046961 13:106167075-106167097 ACATATGGTTTTCACTGAGATGG + Intergenic
1113364210 13:109661393-109661415 ACATGCAGATTTGAGGGACATGG + Intergenic
1113929432 13:113958549-113958571 ACATCAAGGTTTGAGTGCGAGGG - Intergenic
1114218016 14:20672098-20672120 AAATATACAGTTGAGTGAGTAGG + Intergenic
1114559456 14:23579617-23579639 ACATATAGACATGTTTGAGAGGG + Intergenic
1114721481 14:24887446-24887468 AAATATAGATTTTAGGAAGAAGG - Intronic
1115944745 14:38646936-38646958 ACATACAAATTTGAGGGAGAGGG - Intergenic
1116270670 14:42761170-42761192 AGATTAAGATTTGAGTGAGTGGG - Intergenic
1117288587 14:54310676-54310698 ACATGTGGATTTGAGCCAGATGG + Intergenic
1118609356 14:67528095-67528117 TCAGATAGATTGGAGTGTGAGGG + Intronic
1119682297 14:76602005-76602027 ATATATATATTTGTTTGAGATGG + Intergenic
1120161096 14:81145265-81145287 AAATATATATTTGAGGGAAAGGG - Exonic
1120767360 14:88341647-88341669 ATATATATATTTAATTGAGACGG + Intergenic
1124656011 15:31507986-31508008 ACATAAATATTTGTGTGAAAAGG + Intronic
1125704699 15:41723420-41723442 ACATATATTTTTGAGAGAGAGGG + Intronic
1126974088 15:54154643-54154665 ACATATAGATATGAGGAGGAGGG + Intronic
1128531038 15:68448022-68448044 ATATATAGTTTAGATTGAGAGGG + Intergenic
1129125256 15:73434783-73434805 GCAAATAAATTTGAGTGAGTAGG + Intergenic
1130958267 15:88642381-88642403 ACATATGAATTTGAGAGAGCGGG + Intronic
1131496681 15:92917629-92917651 ACACATAGAAGTGACTGAGAAGG + Intronic
1131637364 15:94250752-94250774 ACTTATAGAGTTCAGTGTGATGG + Intronic
1131854253 15:96576122-96576144 ACAGATAGTTGTGATTGAGATGG - Intergenic
1131904881 15:97132416-97132438 AGATAGAGATTTGAGTGATGTGG - Intergenic
1131937307 15:97520982-97521004 ACATTTAGATGTAATTGAGAGGG - Intergenic
1133183727 16:4079604-4079626 ACATACAGATTTAAGTGGAAAGG + Intronic
1133483314 16:6193420-6193442 ATATATAAAATTCAGTGAGAAGG + Intronic
1134380006 16:13715531-13715553 ACATATACATGTGTGTGTGAGGG - Intergenic
1135282370 16:21163695-21163717 ACAAATAAATTTCAGTGAGGAGG + Intronic
1136527081 16:30838330-30838352 ACATATAGATCAGAGATAGATGG + Intronic
1136683303 16:31980230-31980252 ACATATAGAAGTGAGGGAGGGGG + Intergenic
1136783936 16:32923786-32923808 ACATATAGAAGTGAGGGAGGGGG + Intergenic
1136885847 16:33930020-33930042 ACATATAGAAGTGAGGGAGGGGG - Intergenic
1137262191 16:46840414-46840436 ACAAATAAATTTTAGTGAGTAGG + Intergenic
1137466340 16:48713272-48713294 ACATATGAATTTGAGGGGGATGG - Intergenic
1137523286 16:49211852-49211874 ACAGATTATTTTGAGTGAGATGG - Intergenic
1137759604 16:50929519-50929541 ACAAATAAATTTTAGTGAGGAGG - Intergenic
1137917953 16:52453507-52453529 ACATCTAGATTTAAATAAGATGG - Intronic
1138949734 16:61897733-61897755 TCATCTAGATTAGAGTAAGATGG - Intronic
1140845744 16:78885797-78885819 ATATATAGACTTAAGTAAGAAGG - Intronic
1141001430 16:80311994-80312016 ACATATAGATATAACAGAGAAGG - Intergenic
1142400625 16:89856447-89856469 ATATATATATTTGTTTGAGATGG + Intronic
1203086592 16_KI270728v1_random:1187788-1187810 ACATATAGAAGTGAGGGAGGGGG + Intergenic
1142545730 17:701381-701403 ACATATATTTTTGTGTGTGATGG + Intronic
1143454532 17:7057717-7057739 ACATATACATTTGGGGGACAGGG + Intergenic
1144002000 17:11063855-11063877 ACATATGAATTTGAGGGAGGGGG + Intergenic
1145732623 17:27202787-27202809 ATATATATATTTGTTTGAGATGG - Intergenic
1146837320 17:36122417-36122439 AGATAAAGATTTGAGTCAGTAGG - Intergenic
1147144212 17:38475942-38475964 ACATATAGAAGTGAGGGAGGGGG + Intronic
1147470579 17:40656189-40656211 ATATATATATATGAATGAGAGGG - Exonic
1149230445 17:54527851-54527873 ACAAATAAATGTGAGTGAGTAGG - Intergenic
1150117884 17:62570287-62570309 TTATTTAGATTTGAATGAGATGG + Intronic
1150842403 17:68621075-68621097 ACCTATAAATTTCCGTGAGAAGG + Intergenic
1151617460 17:75223306-75223328 ACAGATAAATTTTAGTGAGTAGG + Intronic
1154036289 18:10805510-10805532 ACATATATATTTTTTTGAGATGG - Intronic
1155086570 18:22464545-22464567 ACAGATAGATTAGAGTGGGGAGG - Intergenic
1156377466 18:36527804-36527826 ATATCTATATTTGAGTGACATGG + Intronic
1156812144 18:41265630-41265652 ACAAATAAATTTTAGTGAGTAGG + Intergenic
1158004430 18:52655937-52655959 ACATATATATTTAATGGAGAGGG - Intronic
1158186892 18:54780717-54780739 ACATACAGATTTGGGGGAGGTGG + Intronic
1158274646 18:55754310-55754332 ACATATAAATTTGGGTGGGGAGG - Intergenic
1158413047 18:57224652-57224674 AAATATACATTTGAGAGAGTGGG - Intergenic
1158842117 18:61398830-61398852 ACAAATAGAAATGAGTTAGAAGG + Intronic
1158848107 18:61466051-61466073 ATATATATATTTAAGTGACAAGG - Intronic
1158942916 18:62422498-62422520 ACAAATAGATTTTAGTGAGTAGG + Intergenic
1159670360 18:71214050-71214072 CAATATTGATTTGAGTGAGGAGG + Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
1159957957 18:74533130-74533152 ACATATAAATTTTGGTGGGAAGG - Intergenic
1161547231 19:4888905-4888927 ACATATATATTTTTTTGAGACGG + Intergenic
1161923643 19:7284986-7285008 ACAAATACATTTGAGTGAGTAGG + Intronic
1163150799 19:15412551-15412573 ACATATATATTTTTTTGAGACGG + Intronic
1163213587 19:15859673-15859695 ACAAATACATTTCAGTGAGTAGG - Intergenic
1163464266 19:17457225-17457247 ATATATAGAATAGAGAGAGATGG - Intronic
1163976883 19:20861164-20861186 ACATAAATATTTGTGTGAAAAGG - Intronic
1166062121 19:40332723-40332745 ACAAATACATTTGAATGAGTAGG - Intronic
1167441156 19:49509847-49509869 ACATATATATTTGTGAGACAGGG + Intronic
925842054 2:8001712-8001734 ACATATACATTTTAGGAAGAAGG - Intergenic
928146976 2:28787452-28787474 ACATATATATTTTTTTGAGACGG - Intronic
930676596 2:54207918-54207940 AAATGTAGATTAGAGAGAGAAGG + Intronic
932450151 2:71804522-71804544 ACAAAGTGATTTGAGTGGGAGGG + Intergenic
932952175 2:76306385-76306407 TCATACAGAGTTGAGTGGGAGGG + Intergenic
933549316 2:83754855-83754877 ATATATATATTTGAATGAAAGGG + Intergenic
935118955 2:100163520-100163542 ACATATGGATTAGAATGAAATGG + Intergenic
937170593 2:119862577-119862599 GCATCTAGATTTGACTGAGCAGG + Exonic
937512959 2:122618850-122618872 ACATATGAATTTGGGTGAGGGGG + Intergenic
938539857 2:132276981-132277003 ATGTATATATGTGAGTGAGATGG - Intergenic
940228264 2:151423166-151423188 ACAAATAAATTTTAGTGAGTAGG - Intronic
940574686 2:155486876-155486898 AATTATATATTTGAGAGAGAGGG - Intergenic
941155906 2:161977767-161977789 AGGAATAGATTTGAGGGAGAGGG - Intronic
941257921 2:163257107-163257129 ACAAATAGATTTAACAGAGATGG - Intergenic
941543246 2:166813694-166813716 ACAGATAGATGTGGGGGAGAGGG + Intergenic
941796980 2:169609952-169609974 ACAAATAAATTTTAGTGAGAAGG - Intronic
942037003 2:172019900-172019922 ACATATGGATTTGAGTCAGTAGG + Intronic
943396919 2:187350269-187350291 AAATATAGATGAGAGTGATATGG - Intronic
944117967 2:196209503-196209525 TTATATAGAACTGAGTGAGAGGG + Intronic
944418974 2:199508446-199508468 ACCTATAGGGTTGTGTGAGAGGG - Intergenic
944719895 2:202412988-202413010 ACAAATAAATTTCAGTGAGTAGG - Intronic
944852420 2:203733506-203733528 AGATATAAATTTGGGTGAGTAGG + Intronic
945680654 2:212910078-212910100 ACAAATAGATTTTTGTGAGTAGG - Intergenic
945992360 2:216406754-216406776 ACATTTAGAGTCGAGGGAGAAGG + Intergenic
947196579 2:227573915-227573937 ACCCATAGATTTTGGTGAGAGGG + Intergenic
947504656 2:230698403-230698425 ATATATATATTTTTGTGAGATGG - Intergenic
947689814 2:232124586-232124608 ACATAGAGAACAGAGTGAGAAGG + Intronic
947941334 2:234058493-234058515 ACAAATAAATTTTAGTGAGTAGG + Intronic
1168999435 20:2156755-2156777 ACAAATAAATTTTAGTGAGTAGG - Intronic
1171868792 20:30510023-30510045 ATGTATATATGTGAGTGAGATGG - Intergenic
1174622230 20:51884482-51884504 ACAAATAAATTTCAGTGAGTAGG + Intergenic
1175317702 20:58061477-58061499 ACACATATATTTTAGAGAGAGGG - Intergenic
1175467707 20:59203311-59203333 ACATATATATTTGATCGACAGGG + Intronic
1177389537 21:20450349-20450371 AAAGATAGATTTGAGTGAAAAGG - Intergenic
1177391182 21:20475020-20475042 ACAAATAAATTTTAGTGAGAAGG - Intergenic
1177723051 21:24932141-24932163 ACATATACCTTTGAGTAAGAAGG - Intergenic
1177728924 21:25003316-25003338 TCATGTATATTTGTGTGAGATGG + Intergenic
1177809780 21:25913952-25913974 ATATACAAATTTGAGTGGGAGGG - Intronic
1178333048 21:31717945-31717967 ACATATATATTTTTTTGAGATGG + Intronic
1179353614 21:40637098-40637120 ATATATATATATGAATGAGAAGG - Intronic
1180164732 21:46018871-46018893 ACATACAAATTTGAGAGAGGAGG + Intergenic
1180512684 22:16108687-16108709 CCATATTGATTAGAGTGGGAAGG - Intergenic
1180652200 22:17387276-17387298 AGATATAGATTTGCTTGACAAGG - Intronic
1182748184 22:32621878-32621900 ACACATAGATCTGAGTCAGGAGG - Intronic
1184363624 22:44034384-44034406 ACATATATATATGTTTGAGATGG + Intronic
1184553350 22:45217749-45217771 ACAAATAAATTTCAGTGAGTAGG + Intronic
1184631943 22:45788569-45788591 AATTTTAGATTTGTGTGAGAAGG - Intronic
949254011 3:2023356-2023378 ACAGATTCATTTGAGTCAGATGG + Intergenic
952167048 3:30761691-30761713 ACATATCCATTTGTGTGTGAGGG + Intronic
952491677 3:33880067-33880089 ACATATAGTTTTGAATGACTGGG - Intergenic
952597638 3:35037722-35037744 ACATATAAATTTGGGAGAGATGG + Intergenic
952640968 3:35595338-35595360 AAAAATAGATTGGAGAGAGAAGG + Intergenic
952886569 3:38016056-38016078 ACATATAAATTTTGGTGAGTTGG - Intronic
953266379 3:41393077-41393099 ACATATAGGTCAGACTGAGAAGG - Intronic
953314872 3:41917453-41917475 ATATATATATTTGAGAGACAGGG - Intronic
953430906 3:42839718-42839740 AAAAATAAATCTGAGTGAGATGG + Intronic
953803633 3:46048815-46048837 AAATATAGTTTTGATTGAGGTGG + Intergenic
953953607 3:47212814-47212836 GCATATGTATTTGAGTGAAATGG + Intergenic
954121064 3:48500449-48500471 ACATATTTATTTTTGTGAGATGG - Intronic
954661595 3:52229604-52229626 ACATGGAGATTGGAGTGATAGGG + Intronic
955952655 3:64257791-64257813 ACCTATGAATTTGAGGGAGAAGG - Intronic
956287163 3:67623062-67623084 ATATATATATTTAAATGAGATGG - Intronic
956967215 3:74475746-74475768 ACAAATAAATTTTAGTGAGTTGG - Intronic
957115936 3:76026841-76026863 ATATAGATATTTGAGTGAAAAGG + Intronic
957444585 3:80299134-80299156 ACATCTATATTTTAGTAAGATGG + Intergenic
957829512 3:85497971-85497993 ACAGATAAATTTTAGTGAGTAGG - Intronic
957882726 3:86241430-86241452 TCATATAGATTTGAGTTAGAAGG + Intergenic
958143530 3:89594109-89594131 ACATATTGCTTTGGTTGAGAAGG + Intergenic
958603522 3:96329724-96329746 ACAAATACATTTTAGTGAGTAGG + Intergenic
959483395 3:106900389-106900411 GCATGTAGATTTGAGTGTGGGGG - Intergenic
959850712 3:111083308-111083330 ACATATGGATTTGGGGGAGAAGG - Intronic
960275280 3:115721887-115721909 ACATATAAATTTGGGGGATAGGG + Intergenic
960412869 3:117349381-117349403 ACATATAGATATAAGTGAAATGG - Intergenic
960415683 3:117382553-117382575 ACATATTGATTTTGGAGAGAGGG - Intergenic
961775796 3:129284035-129284057 ACAAATAAATTTTAGTGAGTAGG - Intronic
962358857 3:134718409-134718431 ACAAATAGATTTAAGCCAGATGG - Intronic
963094442 3:141521031-141521053 ACATTCACTTTTGAGTGAGAAGG + Intronic
964240832 3:154592417-154592439 ACAAATAAATTTTAGTGAGTAGG - Intergenic
964311104 3:155393330-155393352 ACATATAGTTTTGAATAAAATGG - Intronic
964780526 3:160332261-160332283 ACTCATAGATCTAAGTGAGAAGG + Intronic
965136480 3:164777970-164777992 ACACATAAATTTTAGTGAGTAGG + Intergenic
966661261 3:182417569-182417591 CCCTAGAAATTTGAGTGAGATGG - Intergenic
967682819 3:192385016-192385038 ATAGATAGATTTGAGGGAAAAGG + Intronic
970215798 4:13758966-13758988 ACATATAGGTTTGTATGAGTAGG + Intergenic
971011893 4:22447209-22447231 AAATATAGATTAGAGTAATATGG + Intronic
971712542 4:30134461-30134483 ATTTATACATTTTAGTGAGATGG - Intergenic
971820921 4:31554020-31554042 AAATATAGATTTGAGGGGTAAGG - Intergenic
972213549 4:36868196-36868218 ACATATAGGCTTCAGGGAGAAGG - Intergenic
972455748 4:39252899-39252921 ATATATAGCTTTGATTCAGATGG + Intronic
972766688 4:42157995-42158017 ACATATATATTTTTTTGAGACGG - Intergenic
973904029 4:55508508-55508530 ATTTATAGATTTGAGTGCTATGG - Intronic
973978789 4:56288765-56288787 ACACATAGATATGAGTCATAAGG + Intronic
974549845 4:63357359-63357381 ACATATAGATTTGATTCGGTGGG - Intergenic
974943131 4:68492264-68492286 ACAAATAAATTTTAGTGAGTAGG - Intronic
975340887 4:73238647-73238669 ATACATAAATTTGAGTAAGACGG + Intronic
975564481 4:75739309-75739331 ACAAATATATTTTAGTGAGTAGG - Intronic
975668989 4:76761279-76761301 ACATAATGCTTCGAGTGAGAGGG - Intronic
975846111 4:78526712-78526734 ACAAATAAATTTTAGTGAGTAGG - Intronic
976358351 4:84147433-84147455 AGATATAGATGTAAGGGAGAGGG - Intergenic
977612562 4:99051187-99051209 AGATATGGATTTGAGTGTGAGGG + Intronic
979058561 4:116025924-116025946 ACATATAATTTTGAGTAATAGGG + Intergenic
979120680 4:116896450-116896472 ACATATGAATTTGAGTGAGGGGG - Intergenic
979168115 4:117562477-117562499 ACATGTAGACTTGAGTCTGAAGG - Intergenic
979317851 4:119287000-119287022 ACTTATAGACTTAAGTGGGAGGG + Intronic
979438860 4:120727333-120727355 ACATATAGATATGATTCATAAGG + Intronic
980450596 4:132965478-132965500 ACATATAAATTTGGGGGAGGAGG - Intergenic
980554674 4:134387515-134387537 ACATATAGATATTTGTGAAATGG + Intergenic
981111122 4:140934646-140934668 ACATTTTGCTTAGAGTGAGAGGG + Intronic
981751713 4:148098662-148098684 ACAAATACATTTTAGTGAGTAGG + Intronic
982796504 4:159652295-159652317 ATATATAAATTTGAGTCAGATGG + Intergenic
983352475 4:166609455-166609477 ACATTTAGTTTTGTGTGAAAAGG - Intergenic
984391837 4:179144503-179144525 TCTTATAGTTTTCAGTGAGAAGG - Intergenic
984550662 4:181155091-181155113 ACATAGAGATATGTGAGAGATGG - Intergenic
985022297 4:185704693-185704715 ACATGGAGAGTTGAGGGAGAGGG - Intronic
985795608 5:1959650-1959672 ACAAATAAATTTTAGTGAGTAGG - Intergenic
986901172 5:12435528-12435550 ATATATATATTAGAGAGAGAGGG - Intergenic
987532302 5:19137130-19137152 ACATATATATTTTTTTGAGACGG - Intergenic
988106902 5:26762125-26762147 ACAGATAGATGAGAGAGAGAGGG + Intergenic
990052465 5:51522029-51522051 TCATATTAATTTGAGTGATAAGG - Intergenic
991609574 5:68436382-68436404 ATATATAGGTTTGAGTGACCTGG + Intergenic
991771778 5:70047861-70047883 ACATATTTATTTGTTTGAGATGG + Intergenic
991851068 5:70923269-70923291 ACATATTTATTTGTTTGAGATGG + Intergenic
992242217 5:74783888-74783910 ACAAATAGATTTGACTGTGTAGG + Intronic
992501329 5:77347113-77347135 ACATATAGAGTTTAGATAGATGG - Intronic
992711098 5:79457244-79457266 ACAGATAAATTTTAGTGAGTAGG - Intronic
994838851 5:104894654-104894676 AAATATAAATTTGAATGAGAAGG + Intergenic
995025347 5:107414273-107414295 ACATATTGATTTGAGGGACAAGG - Intronic
995418827 5:111939478-111939500 ACAAATAAATTTAAGTGAGTAGG - Intronic
995613562 5:113936745-113936767 ATATATATATATGAATGAGAAGG + Intergenic
997903560 5:137791697-137791719 ACAAATAAATTTTAGTGAGTAGG + Intergenic
999397729 5:151240818-151240840 ACATACAGTGTTGAGTGATAGGG + Intronic
1000151123 5:158501791-158501813 ACATATATATTTTTTTGAGATGG - Intergenic
1000977397 5:167780260-167780282 ACAAATAAATTTAAGTGAGTTGG - Intronic
1001367094 5:171153142-171153164 GGATATTGATTAGAGTGAGATGG + Intronic
1004505542 6:16243998-16244020 ACATAAGGATTTGGGTGAGAAGG + Intronic
1005711925 6:28511516-28511538 ACAGACCCATTTGAGTGAGAAGG - Intronic
1008139209 6:47812538-47812560 AGATGTAGATATGAATGAGATGG + Intronic
1009824673 6:68851874-68851896 AGATATAGATTTCACGGAGACGG + Intronic
1012182524 6:96172260-96172282 ACATATAAATTTGGGAGAGCGGG + Intronic
1012309080 6:97698516-97698538 AGATATAGATTTTAGTAAGACGG + Intergenic
1012962254 6:105634700-105634722 AACAATAGATTTGAGTGAGAAGG - Intergenic
1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG + Intronic
1014970703 6:127811631-127811653 ATATAAATATTTGAGTGAGGGGG + Intronic
1015073259 6:129123341-129123363 ACATATATATATGTGTGAGAAGG - Intronic
1015178231 6:130334737-130334759 ATATATAGTTTTGAGTAAGGGGG - Intronic
1015470034 6:133594364-133594386 ACAGTTAGAATTGACTGAGATGG + Intergenic
1021767371 7:23963421-23963443 ACAGGTAAATTTGAGTCAGATGG + Intergenic
1022180740 7:27916891-27916913 ACAAATACATTTTAGTGAGAAGG + Intronic
1023320471 7:38991858-38991880 AGATAGAGATGTGAGAGAGAGGG - Intronic
1023440023 7:40175925-40175947 ACAAATAAATTTTAGTGAGTAGG + Intronic
1024371289 7:48586901-48586923 ACATCTAGAGTTCAGGGAGAAGG - Intronic
1024411827 7:49052062-49052084 AGATATAGATTTTGGAGAGAGGG - Intergenic
1027576482 7:79937015-79937037 ACATAAATAATTGAATGAGAAGG - Intergenic
1028552627 7:92087181-92087203 ACAAATACATTTTAGTGAGAAGG + Intronic
1028663180 7:93307593-93307615 ACAAATAAATTTCAGTGAGTAGG + Intronic
1028978042 7:96935893-96935915 ACATATGAATTTGAGGGAGGAGG - Intergenic
1030720571 7:112865578-112865600 ATATATATATATGAATGAGACGG - Intronic
1030844775 7:114395671-114395693 AGATGTAGATTTGAGAGAGCAGG + Intronic
1031412735 7:121459172-121459194 ACCTATACATTTGAATGGGAAGG - Intergenic
1031658738 7:124393669-124393691 ACAGCTAGGTTTGAGTGTGAAGG - Intergenic
1031784149 7:126007552-126007574 GCAGATAGATATGAATGAGACGG - Intergenic
1033672679 7:143508253-143508275 ATATATATATTTGTTTGAGATGG + Intergenic
1033971328 7:147044163-147044185 ACATATATATGTAAATGAGAAGG - Intronic
1034842145 7:154408833-154408855 ACATATAAATTTGAGTTGGGGGG - Intronic
1035978280 8:4337426-4337448 ACATTTAGATTTAACAGAGAAGG - Intronic
1036942148 8:13062029-13062051 ACAAATAAATTTTAGTGAGTAGG + Intergenic
1036987172 8:13547327-13547349 TCATATAGACTTGTGTAAGAGGG + Intergenic
1037611120 8:20477144-20477166 AAATATGGAGTTGAGTGAGTGGG - Intergenic
1037792589 8:21959108-21959130 ACAAATACATTTTAGTGAGTAGG + Intronic
1038391444 8:27205457-27205479 AGAAATGGATTTGAGGGAGAGGG + Intergenic
1038881441 8:31618044-31618066 ACATATAACTCTGAGTGGGAAGG + Intergenic
1038925583 8:32135821-32135843 ACTTATAGATATGAAAGAGAAGG + Intronic
1039714831 8:40096636-40096658 GGATAAAGATTTGACTGAGAAGG - Intergenic
1041054195 8:53965662-53965684 ACATATAGGTTTAAGTGATTGGG + Intergenic
1041079646 8:54204110-54204132 ATATATATATATGAGTAAGATGG - Intergenic
1043217824 8:77617924-77617946 ACATATAGCTGTGAGTGTTAGGG - Intergenic
1043795577 8:84534467-84534489 ACTTATAGCTTAGAGGGAGAAGG - Intronic
1044167009 8:88997823-88997845 ATATATAGATTTGAGGGTGTGGG - Intergenic
1044799483 8:95938948-95938970 ACAAATAAATTTTAGTGAGTAGG - Intergenic
1044876292 8:96670398-96670420 ACAAATAAATTTTAGTGAGTAGG + Intronic
1045008849 8:97939752-97939774 ACAAATACATTTTAGTGAGTAGG + Intronic
1045275552 8:100701379-100701401 ACAAATAAATTTTAGTGAGTAGG + Intronic
1046406079 8:113774434-113774456 ATATATTGATTTGAGTAGGATGG - Intergenic
1047242353 8:123102605-123102627 ACAAATAAATTTTAGTGAGCAGG - Intronic
1048227429 8:132601994-132602016 ACACATAGAATAGAGTGAGAAGG - Intronic
1052221763 9:26032497-26032519 ACATATAAATTTGGGAGGGAGGG + Intergenic
1055121548 9:72666042-72666064 ACATAAATGTTTTAGTGAGAAGG + Intronic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055253789 9:74341039-74341061 ACATATGGAATAGAGTGAAATGG + Intergenic
1056171779 9:83992669-83992691 ACAAATAAATTTTAGTGAGTAGG + Intronic
1056623026 9:88230486-88230508 ACATGTACTTTTGAGTTAGATGG + Intergenic
1056807135 9:89737533-89737555 ACACAAAGATGTGAGTGATAGGG + Intergenic
1057224355 9:93281542-93281564 ATATAGAGATTACAGTGAGATGG + Intronic
1058414013 9:104765945-104765967 ACATATGGTATTGAGTAAGATGG + Intronic
1058649579 9:107162414-107162436 ACAAATAAATTTTAGTGAGTAGG - Intergenic
1059448288 9:114353165-114353187 ACATATAGATTTCATAGACATGG + Intronic
1059999010 9:119941674-119941696 ACATATGAATTTGTGTGGGAGGG - Intergenic
1060628395 9:125134370-125134392 GGATATAGATATGAGTGAGGTGG - Intronic
1060706746 9:125809280-125809302 ACAAATAAATTTTAGTGAGTAGG + Intronic
1062083366 9:134636154-134636176 CCATCTAGATGTGGGTGAGAGGG - Intergenic
1203346895 Un_KI270442v1:41329-41351 ACAAATAGAATGCAGTGAGATGG + Intergenic
1185919337 X:4072511-4072533 AAATAAAAATTTCAGTGAGAAGG + Intergenic
1188235454 X:27724846-27724868 ACATATACTTTAAAGTGAGAGGG + Intronic
1188379468 X:29473366-29473388 ATATATAAATTTGAGAGGGATGG + Intronic
1188458751 X:30397559-30397581 AAATATAAATTTGACTGAAATGG + Intergenic
1188663764 X:32792594-32792616 ACATATAGATTTGAAGTAAAGGG + Intronic
1188883704 X:35523109-35523131 ACAAATAAATTTTAGTGAGTAGG + Intergenic
1188936817 X:36185964-36185986 ACATATAAATTTGGGGGTGAAGG + Intergenic
1189402287 X:40681995-40682017 AAATATAAATTTGAGTAACAGGG + Intronic
1189666742 X:43363759-43363781 ACATGTACATTTCAGAGAGATGG - Intergenic
1190492799 X:50999733-50999755 ACATTTAGATTTGATTGAATGGG + Intergenic
1190511843 X:51180824-51180846 ACATTTAGATTTGATTGAATGGG - Intergenic
1191060466 X:56290401-56290423 ACAGATAAATTTGAGTAAGAAGG + Intergenic
1195791779 X:108596069-108596091 ACATATAGTTTTGACTGGAAAGG - Intronic
1196009477 X:110871725-110871747 ACGTATGAATTTGAGGGAGATGG + Intergenic
1196018171 X:110961482-110961504 ACATCTAGGTTTGAGGTAGAAGG - Intronic
1196678162 X:118442364-118442386 ACATATAGTATGGAGAGAGATGG - Intronic
1196706514 X:118722036-118722058 ACATATAGTTTTGAGTGCTGGGG + Intergenic
1197215351 X:123861681-123861703 ATATATATATTTGTGTGGGAAGG - Intronic
1198037448 X:132815119-132815141 ACATATATTTTTGAGTGTTAGGG - Intronic