ID: 1013443908

View in Genome Browser
Species Human (GRCh38)
Location 6:110201406-110201428
Sequence CAGCTGCACTGAACCGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013443903_1013443908 14 Left 1013443903 6:110201369-110201391 CCCAGGGGCTGACAAATGGTGCT 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG 0: 1
1: 0
2: 1
3: 5
4: 53
1013443900_1013443908 27 Left 1013443900 6:110201356-110201378 CCTCTCCTTCTGTCCCAGGGGCT 0: 1
1: 1
2: 2
3: 41
4: 482
Right 1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG 0: 1
1: 0
2: 1
3: 5
4: 53
1013443904_1013443908 13 Left 1013443904 6:110201370-110201392 CCAGGGGCTGACAAATGGTGCTA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG 0: 1
1: 0
2: 1
3: 5
4: 53
1013443901_1013443908 22 Left 1013443901 6:110201361-110201383 CCTTCTGTCCCAGGGGCTGACAA 0: 1
1: 0
2: 0
3: 15
4: 236
Right 1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG 0: 1
1: 0
2: 1
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013443908 Original CRISPR CAGCTGCACTGAACCGTATC AGG Intronic
905260937 1:36718635-36718657 CAGCTGCACTGGGCCCTAACCGG + Intergenic
909557622 1:76971319-76971341 TAGCTATACTGAACTGTATCCGG - Intronic
913290508 1:117267633-117267655 CAGCTGCTCTGAACCTGAGCCGG + Intergenic
924607912 1:245551107-245551129 AGGCTGCAGTGAACCGTGTCAGG - Intronic
1067820205 10:49521679-49521701 CCTCTGCACTGAACTGTATCTGG - Intronic
1067844309 10:49707533-49707555 CAGCTGCTCTGAATCTTATTTGG - Intronic
1067917601 10:50417874-50417896 CAACTGCACTGAACCTTCTCAGG + Intronic
1081741960 11:45447137-45447159 CAGCTGCTGTGGACCGGATCAGG - Intergenic
1083991811 11:66250805-66250827 CAGCTGCACTGAGCCCTGTGTGG - Intergenic
1086394225 11:86397574-86397596 CTGCTGCACTGAACCTGAACAGG - Intronic
1088494283 11:110418094-110418116 CAGGTGGACTGAACCGGTTCTGG + Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1100201753 12:92306252-92306274 CAGCTGCATTCAACAGTAACTGG + Intergenic
1101646183 12:106632850-106632872 CAGGTGCACGCCACCGTATCTGG + Intronic
1106701339 13:32232504-32232526 CACCTGCACTGAACTGTTACAGG - Intronic
1115453739 14:33577874-33577896 CAGGTGCACTGACCTGTATAAGG + Intronic
1121240633 14:92427534-92427556 CCACTGCACTGACCCGTAACTGG - Intronic
1129302146 15:74631622-74631644 CAGCTGCAAAGGACCGTTTCAGG + Exonic
1135281628 16:21158287-21158309 CAGCTGCTCTGGAACGTCTCTGG - Intronic
1141762785 16:86039590-86039612 CAGCTCCACTGAACTCTATTGGG - Intergenic
1145250012 17:21292114-21292136 CATCTGCACTGGACAGTCTCTGG + Intronic
1151935360 17:77257782-77257804 CGGCTGCACTGGCCCTTATCTGG - Intergenic
1158982219 18:62774237-62774259 CAGCTGCAGTGAACAGTATCAGG - Intronic
924995885 2:360391-360413 CAGCTGCAGAAAACAGTATCGGG + Intergenic
925695914 2:6578060-6578082 CAGCTGCATTGAAGGGTTTCAGG - Intergenic
927408279 2:22796939-22796961 CAGCTCCACTGAACCTTCTGGGG + Intergenic
927500526 2:23579867-23579889 CAGCTGAACTCACCCGCATCAGG - Intronic
931798527 2:65735791-65735813 CAGCTGCACTGTACCCTATTAGG + Intergenic
932275063 2:70445432-70445454 CAGGTGCACTGAACTGTCTGGGG - Intergenic
932838866 2:75062778-75062800 CAGCTGCACTGGGCACTATCAGG + Intronic
947862735 2:233373518-233373540 CAGCTGCCCTCAGCCTTATCTGG + Intronic
1168980813 20:2002289-2002311 CAGCTGCACAGAACTCTTTCTGG - Intergenic
1169274063 20:4221402-4221424 CAGCTGCCCTGATCAGTTTCCGG + Exonic
1175642753 20:60644663-60644685 CAGCTGCACTGCACCACATGTGG + Intergenic
952797994 3:37260296-37260318 CAGTTGTACTTAACAGTATCTGG + Intronic
954410987 3:50370985-50371007 CAGCTGCCCCGACCCGTCTCTGG - Intronic
968229499 3:196997003-196997025 CAGCTGCCCTGAAACTTCTCAGG + Intronic
969281863 4:6176229-6176251 CAGCTGGTCTGAAACGTATGAGG - Intronic
980138568 4:128887193-128887215 TAGGTGCACTGGACAGTATCTGG - Intronic
994409765 5:99392240-99392262 TAGCTTCCCTGAACCGTATCTGG - Intergenic
994484055 5:100373040-100373062 TAGCTTCCCTGAACCTTATCTGG + Intergenic
995837514 5:116413260-116413282 CACCTGCACTGAACTATACCTGG + Intergenic
999791579 5:154944883-154944905 CAGCTCCAAGGAACCATATCTGG + Intronic
1001892251 5:175349403-175349425 CAGCAGCGCTGAACCTTAACTGG - Intergenic
1002620810 5:180486880-180486902 CAGCTGCACTCAAGCATATATGG - Intergenic
1013443908 6:110201406-110201428 CAGCTGCACTGAACCGTATCAGG + Intronic
1019325899 7:438144-438166 CAGCTGCACGGAAGCGAAGCCGG + Intergenic
1020430286 7:8111224-8111246 CAGTTGCACTGAACCCTTTGGGG - Intergenic
1022189000 7:27998637-27998659 CAGCAACACTTAACCGCATCTGG - Intronic
1023177918 7:37451455-37451477 AATCTTCACTTAACCGTATCTGG - Intergenic
1025769484 7:64490752-64490774 CAGGTGGACTGAACCGGTTCAGG - Intergenic
1027265666 7:76494030-76494052 CAGCAGCACTGAACCGTCATAGG - Intronic
1027317036 7:76992147-76992169 CAGCAGCACTGAACCGTCATAGG - Intergenic
1029173366 7:98646304-98646326 CATCTCCACTGATCCGGATCAGG + Intergenic
1037531079 8:19774662-19774684 CAGTTTCACTGAACTGTATCTGG - Intergenic
1045758684 8:105575886-105575908 CAGCTTAACTGAACCATATGTGG - Intronic
1056868756 9:90256546-90256568 AAGCTGCACTGCACTGTTTCTGG - Intergenic
1197002057 X:121451160-121451182 CAGCAGCACTCAACCATAACAGG + Intergenic
1200483891 Y:3743507-3743529 CAGCTGCACTGATACTTGTCTGG + Intergenic
1202054206 Y:20813214-20813236 CATCTGCACTGAACCCAAACAGG - Intergenic