ID: 1013457307

View in Genome Browser
Species Human (GRCh38)
Location 6:110342277-110342299
Sequence TCCCAACAGCTCCCCAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013457307_1013457313 27 Left 1013457307 6:110342277-110342299 CCATGCCTGGGGAGCTGTTGGGA 0: 1
1: 0
2: 3
3: 27
4: 307
Right 1013457313 6:110342327-110342349 GCCAGAAGAAGATTCCTGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013457307 Original CRISPR TCCCAACAGCTCCCCAGGCA TGG (reversed) Intronic
900419775 1:2550909-2550931 TCCCAACCCCTCCCCAGCCCTGG + Intergenic
900425196 1:2575129-2575151 TCCCAACCCCTCCCCAGCCCTGG - Intergenic
900682785 1:3925996-3926018 TGCCAACAGCCCTCCAGTCAGGG - Intergenic
900916052 1:5639470-5639492 TCCCAAGACCAGCCCAGGCAGGG + Intergenic
900996434 1:6125705-6125727 TGCCATCAGCTCCCCTGACATGG + Intronic
901044348 1:6386457-6386479 TCCCACCTGCTCCCCATGCCAGG + Intronic
901391891 1:8951512-8951534 TCCCACCAGCTGTCCAGGGAGGG - Intronic
901922156 1:12545074-12545096 TTCCCACAGTTCCCCAGCCAGGG - Intergenic
903231947 1:21927446-21927468 GGCCCAGAGCTCCCCAGGCAAGG + Intronic
904280057 1:29412829-29412851 AGCCAACAGCTCCACAGGCCTGG - Intergenic
904333951 1:29785026-29785048 CCCCAACACCTCCCCACTCAAGG - Intergenic
904344551 1:29859447-29859469 GCCGAACAGCTCCCCACACAGGG - Intergenic
904396824 1:30227862-30227884 GCTGAACAGCTCCCCATGCAGGG + Intergenic
905174603 1:36127605-36127627 CCCCATCAGATCCCCATGCAGGG - Intergenic
905370667 1:37481117-37481139 TCCCAGCAGCTCCCCAGGTGGGG + Intronic
905947453 1:41916161-41916183 TCTCAACAGCTCACTTGGCAAGG + Intronic
906518022 1:46450924-46450946 CCCCCACTGCTCCCCAGACAGGG + Intergenic
906743757 1:48207423-48207445 GGGCAGCAGCTCCCCAGGCATGG - Intergenic
907170825 1:52462588-52462610 TCCCAACAGCTCTGCAGGACAGG - Intronic
909332075 1:74425608-74425630 TACCAATAACTCCCCTGGCATGG + Intronic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
912453960 1:109785592-109785614 ACCCCACAGCCACCCAGGCATGG - Intergenic
912598982 1:110908371-110908393 TCACACTAGCTCCCCAGCCATGG + Intergenic
912701456 1:111881414-111881436 TCCCAACAGCTGCCCGCACAGGG + Intronic
914239536 1:145844046-145844068 TCCCAACAGTGTACCAGGCAGGG - Intergenic
915331608 1:155116320-155116342 GCCCAACACCTCCCCAGACATGG + Intergenic
915460234 1:156066113-156066135 ACCCAGCAGCCCCCCAGGCCCGG - Intronic
915661623 1:157410075-157410097 GTCCAACAGGTCCCCAGACACGG - Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
917144121 1:171869310-171869332 AGCCCACAGCTCCTCAGGCATGG - Intronic
917969543 1:180197989-180198011 TCCACACACCTCCCAAGGCAGGG - Exonic
920017950 1:202928396-202928418 TCCCTACCGCTCACTAGGCAGGG + Intronic
920179927 1:204126302-204126324 GGCCAACAGCTCCTCAGGAAGGG - Exonic
920248369 1:204605455-204605477 TCCCCACCCATCCCCAGGCAGGG - Intergenic
1062947522 10:1472754-1472776 ACCCTGCAGATCCCCAGGCAGGG - Intronic
1065102661 10:22345885-22345907 CCCCAAGAGCTCCACGGGCAGGG - Intronic
1067816847 10:49485171-49485193 TCACAGCAGCTCCCCAAGGAAGG + Intronic
1068072745 10:52216335-52216357 TCCCAAAAGATCCCCAGCCCAGG - Intronic
1068518931 10:58058048-58058070 TCACAACAGCTCTCCAGCAAGGG + Intergenic
1068814290 10:61292258-61292280 TCCCACCAGCTCTGCAGTCAGGG - Intergenic
1069545063 10:69321637-69321659 TCCCAAAAACTTCCCCGGCATGG - Intronic
1069901176 10:71707424-71707446 TCTCAACAGGTCCCCAAGGAAGG - Intronic
1070595577 10:77830580-77830602 TCCCAGCAGCTGTCCAGGCTGGG - Intronic
1070622954 10:78028057-78028079 TCCACACAGCTGCCCAAGCAAGG + Intronic
1070745305 10:78930161-78930183 ACCCATGAGCTCACCAGGCAGGG + Intergenic
1071265439 10:83960612-83960634 TCCCAACAACTCGCCAGACCAGG - Intergenic
1073046718 10:100643517-100643539 TCCCAACAGCTCCCCAGGGTAGG + Intergenic
1073143600 10:101264804-101264826 TCCCAGCAGCTCCCCAGAAGGGG + Intergenic
1073470925 10:103721636-103721658 TCCCAACAGCCACCCACGTAGGG + Intronic
1074571593 10:114629350-114629372 TCCTGACAGCTCCACAGGGAAGG + Intronic
1075244051 10:120804713-120804735 TTCCTCCAGCTTCCCAGGCATGG + Intergenic
1075782398 10:125026038-125026060 TCCCCCCAGGTCCCCAGGCAGGG + Intronic
1076903589 10:133351592-133351614 TGTCAACAGCGCCCCATGCAGGG + Intronic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077499144 11:2901462-2901484 CCCCACCTCCTCCCCAGGCAAGG - Intronic
1077514193 11:2992026-2992048 TCCCGCCAGCGCCCCAGGCCCGG + Intronic
1078058937 11:8031363-8031385 TCCCAGAAACTGCCCAGGCAAGG - Intronic
1079246171 11:18753774-18753796 GCCCACCAGCTCCCCAGCCATGG - Intronic
1079320580 11:19448235-19448257 TGCCCACACCTCCTCAGGCAGGG - Intronic
1083240549 11:61384773-61384795 TCCCCAAAGCCCTCCAGGCATGG - Intergenic
1083366509 11:62144812-62144834 CCCCAACAGCACCCAAGCCAAGG - Intronic
1083880267 11:65544978-65545000 TCCCAAAAGCTACCCTGCCAAGG + Intronic
1084712669 11:70853553-70853575 TCCCAACAGCTCCACCAGCCCGG + Intronic
1085273891 11:75286000-75286022 ACCAAACAGCATCCCAGGCAGGG + Intronic
1085313613 11:75530483-75530505 TCCAACCAGCTCTCCAGGCCAGG - Intergenic
1085389626 11:76175804-76175826 TCCCACCACCACCCCAGGAATGG - Intergenic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1085811911 11:79690822-79690844 TTCCTACACCTCCCCTGGCAGGG - Intergenic
1086138505 11:83467592-83467614 TCCAAAAAGTTCACCAGGCATGG + Intronic
1089589727 11:119532691-119532713 CCCCAACAGCTCCCCTACCAGGG - Intergenic
1089696985 11:120221995-120222017 TCCCAACAGATTCCTGGGCAAGG + Intronic
1090756816 11:129798901-129798923 TCACACCAGCTCCCCAGCAATGG + Intergenic
1090788244 11:130069181-130069203 TCCCAGCAGTTGCCCAGGCAGGG - Intergenic
1091347589 11:134865462-134865484 GCCCCACAGTTCCCCAGGAATGG - Intergenic
1091992625 12:4968473-4968495 TCACAACAGCTCTACAGGGAAGG + Intergenic
1092205659 12:6613150-6613172 TCCCAGCAGCTCTGCAGGGAGGG - Intergenic
1093043646 12:14415458-14415480 TACCAACAATTCCCCAGACAAGG - Intronic
1096173980 12:49499356-49499378 TCCCCAGAGCTCACCAGGCCAGG - Intronic
1096626232 12:52897697-52897719 TCCCAACATAGCCCCAGGGATGG + Intronic
1098193502 12:67976095-67976117 TCACAACAGCTCTCCAGCAAGGG - Intergenic
1100442995 12:94634695-94634717 TCCCTACTGCTCCCCAGGTAGGG + Intronic
1100970428 12:100063899-100063921 TCACAACAGCTCACCAGCAATGG + Intronic
1101545260 12:105706432-105706454 TCCTAGCAGCTGCCCAGGCGAGG + Intergenic
1104582122 12:130018742-130018764 TCCTTACACCTCCCCAGGGAAGG + Intergenic
1104648519 12:130514202-130514224 GCCCAGCAGCTCACCCGGCATGG - Intronic
1104800953 12:131554995-131555017 AGCCCAGAGCTCCCCAGGCAAGG + Intergenic
1105475609 13:20725926-20725948 TACCAACAGTTCCACAGTCAGGG + Intergenic
1107707304 13:43120901-43120923 TCACAACAACTTTCCAGGCAGGG - Intergenic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1107840455 13:44451814-44451836 CCCCAACAGCCCCACAGGTAAGG - Intronic
1111394288 13:87644501-87644523 TCTCAACAGGTGGCCAGGCATGG - Intergenic
1112225206 13:97533010-97533032 TCCTGACATCTCCCCAGCCATGG - Intergenic
1112567733 13:100565743-100565765 TCCCCACAGCTGGACAGGCAGGG - Intronic
1113847629 13:113401635-113401657 TCCCCACAGCTCCCCCGACAGGG - Intergenic
1113978508 13:114251215-114251237 TCCCACTACCTCTCCAGGCAGGG - Intronic
1114340382 14:21736811-21736833 TACCAACAGTTTCCCAGCCAAGG + Intergenic
1114756718 14:25268507-25268529 TCACAACAGCTCCCTAGCAATGG - Intergenic
1116296682 14:43119814-43119836 TCCCAGCCACTCCCCAGCCATGG - Intergenic
1119220078 14:72899557-72899579 TTCTAAGAGCTCCCCAAGCAAGG - Intergenic
1121316563 14:92964446-92964468 TCCAAACAAGGCCCCAGGCAGGG + Intronic
1121681657 14:95797916-95797938 TCTGAAGATCTCCCCAGGCAGGG + Intergenic
1122692818 14:103539193-103539215 TCCCACCAGCTTCCCGCGCAGGG + Intergenic
1124483640 15:30098176-30098198 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124519939 15:30399050-30399072 TCCCAACAGCACCCTAGAAATGG - Intergenic
1124538716 15:30567172-30567194 TCCCAACAGCACCCTAGAAATGG + Intergenic
1124598609 15:31112500-31112522 TCCCAAATGCTCCCCAGTCCTGG + Intronic
1124630489 15:31334071-31334093 CCCCAACATCTCTCCAGTCAAGG - Intronic
1124759934 15:32440408-32440430 TCCCAACAGCACCCTAGAAATGG - Intergenic
1126054171 15:44713903-44713925 TCCCCACAGCCTCCCAGACAAGG + Intronic
1127772170 15:62241200-62241222 TCCCAACAGCACCCTAGTAATGG - Intergenic
1128565444 15:68697946-68697968 TCCCAGCACCTCAGCAGGCAGGG - Intronic
1129039219 15:72671116-72671138 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129208862 15:74054019-74054041 TCCAGCCAACTCCCCAGGCAGGG + Intergenic
1129210602 15:74065811-74065833 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129364807 15:75047693-75047715 TCCTCACAGCTGCCCAGGGAGGG + Intronic
1129403408 15:75299518-75299540 TCCCAACAGCACCCTAGAAATGG + Intergenic
1129602613 15:77009176-77009198 TCCAACTAGCCCCCCAGGCACGG + Intronic
1129727804 15:77910448-77910470 TCCCAACAGCACCCTAGAAATGG - Intergenic
1129772496 15:78211748-78211770 TCCCATCAGCTCCTCTGGCAAGG - Intronic
1129840073 15:78738412-78738434 TCCCAACAGCACCCTAGAAATGG + Intergenic
1130034134 15:80342224-80342246 TCCCAACCCCACCCCAGGCCTGG + Intergenic
1130340295 15:82995492-82995514 TCAGAACAGCTGGCCAGGCACGG + Intronic
1131516410 15:93080530-93080552 TCACAGCTGCTCCCCAGGCACGG + Intronic
1132185175 15:99797475-99797497 TCCCAACAGCACCCTAGAAATGG + Intergenic
1132431813 15:101767080-101767102 TCCCAACAGCACCCTAGAAATGG - Intergenic
1132713451 16:1279231-1279253 TGGCCACAGCTCACCAGGCAGGG + Intergenic
1133523155 16:6578421-6578443 TTCCATCAGCTACCCAGCCAAGG - Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1134914724 16:18060155-18060177 GCACAAAAGCTCCCCAGTCAAGG + Intergenic
1135503640 16:23017960-23017982 TCCCACCCCCTCCCCAGGCTGGG + Intergenic
1135989615 16:27210076-27210098 TCTCTCCACCTCCCCAGGCACGG + Exonic
1136140360 16:28284326-28284348 TCCCAGCTCCTCCACAGGCATGG - Intergenic
1136246084 16:28976925-28976947 TACTATCAGCTCCCAAGGCAAGG - Intronic
1136293728 16:29290399-29290421 TCTCTACAGCACCCCAGGCTTGG - Intergenic
1137704054 16:50521636-50521658 TCCCAACACCTCCAGAGGCAAGG - Intergenic
1138540075 16:57682589-57682611 TACCACCAGCTCCCCAGGGTGGG + Intronic
1140332659 16:74072889-74072911 ATCCAGCAGCTTCCCAGGCAGGG + Intergenic
1140630960 16:76851698-76851720 TCTCAACAGCTTCCCATCCAGGG + Intergenic
1141107716 16:81247285-81247307 TCCCAACAGCTCTCCAGGGGAGG - Intronic
1141747634 16:85936434-85936456 TCCCAACACGTTCCCAGGCTGGG + Intergenic
1142099611 16:88264405-88264427 TCTCTACAGCACCCCAGGCTTGG - Intergenic
1142189494 16:88711345-88711367 TCCCAACAACGCCCCAGGAGAGG - Intronic
1142271808 16:89093836-89093858 GCCCAACAGCTTCCCCGGCGCGG - Exonic
1143486005 17:7254639-7254661 TCCCAGCGGCCCCCCAGGAAAGG - Exonic
1143912716 17:10265193-10265215 TCCCCACAGCAGCCTAGGCAAGG - Intergenic
1145167437 17:20625223-20625245 TCACAACAGCTTCCCAGCAATGG + Intergenic
1145302787 17:21652858-21652880 TCCCAGGAGCTCCCCTGGCCTGG - Intergenic
1145347517 17:22050332-22050354 TCCCAGGAGCTCCCCTGGCCTGG + Intergenic
1146953753 17:36923888-36923910 CACTAACAGTTCCCCAGGCAGGG - Intergenic
1147187786 17:38722071-38722093 CCCCAACAGCCCCTCAGCCATGG - Exonic
1147362171 17:39937839-39937861 TCCCATCACCTGGCCAGGCACGG + Intergenic
1148089208 17:45012853-45012875 TCCACACTCCTCCCCAGGCAGGG + Intergenic
1148789929 17:50167359-50167381 TCCCCACAGTTCTCCTGGCAGGG + Exonic
1148896656 17:50842895-50842917 CCACAGCAGCTCCCGAGGCATGG + Intergenic
1149565099 17:57635649-57635671 GCAGCACAGCTCCCCAGGCAGGG + Intronic
1149992177 17:61389414-61389436 TCCTAACAGTTCCCAGGGCAAGG - Intronic
1149999269 17:61422857-61422879 TTCCAACTGCTCCACATGCAGGG - Intergenic
1151820261 17:76493222-76493244 TCCCAGCAGGGCCACAGGCAGGG - Intronic
1151946553 17:77323003-77323025 GCCCTACAGCTGCCCAGGAAGGG + Intronic
1151981001 17:77508429-77508451 TCTCAACACCTCCCCACTCAGGG - Intergenic
1152078537 17:78172673-78172695 TCCAAACAGCATCCCAGGCCGGG - Exonic
1152356099 17:79808253-79808275 TCTCAGCAGCAGCCCAGGCATGG - Intergenic
1152920530 17:83064328-83064350 GCCCTCCAGCTCCCCAGGCCTGG - Intergenic
1153277349 18:3380527-3380549 TCCCAGCTGCTCCGGAGGCAAGG + Intergenic
1154066516 18:11111571-11111593 TCCCTACAGGGTCCCAGGCAGGG - Intronic
1154147092 18:11875263-11875285 TCCCAACAGCTCTGCAGGGAGGG + Intronic
1154356784 18:13627705-13627727 TCCAGTCATCTCCCCAGGCAAGG + Intronic
1155332875 18:24735302-24735324 TTCCAACTGGGCCCCAGGCAAGG - Intergenic
1156464752 18:37341696-37341718 GCCCAACTCCACCCCAGGCAGGG - Intronic
1156536701 18:37871309-37871331 TTCAAACAGCCCCACAGGCAGGG - Intergenic
1159219425 18:65440267-65440289 TCCAAAAAGCTCCACTGGCAGGG + Intergenic
1159802331 18:72916937-72916959 TCACACCAGCTCCCCAGCAATGG - Intergenic
1160297786 18:77654051-77654073 ACCCCACTGCTACCCAGGCAGGG + Intergenic
1160394157 18:78559642-78559664 CTACCACAGCTCCCCAGGCAGGG - Intergenic
1160503135 18:79411986-79412008 TCCCATCTGCACCCGAGGCAGGG - Intronic
1160917381 19:1503684-1503706 TCCCAGGGGCTCCCCAGCCAAGG - Intergenic
1161039997 19:2105210-2105232 TCCCAACACCTCCCCAGCCTGGG - Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161821115 19:6531742-6531764 CCCCATCAGCACCCCAGGCCAGG + Intronic
1161854289 19:6754533-6754555 TCCAAACAGCTCCCCACTCATGG - Intronic
1161990409 19:7681280-7681302 TCCACACACCTCCCCATGCATGG + Intronic
1162402245 19:10453303-10453325 TCCCACCAGCCCACCAGCCAAGG - Intronic
1163329697 19:16628394-16628416 TCCCAACGGCTGCCTAGGCCGGG - Intronic
1164772205 19:30818188-30818210 ACCCAACAAATCACCAGGCATGG + Intergenic
1166069785 19:40380420-40380442 TCCCAGCTGCTGCCCCGGCAGGG + Exonic
1166965891 19:46529152-46529174 TCCCAGCAGATCACCAGGCTGGG + Intronic
1167661404 19:50798017-50798039 ACCGAACAGCTCCACAGGGAGGG + Exonic
925308271 2:2865273-2865295 TCCCCACACCACCCCAGACAGGG - Intergenic
928212212 2:29331673-29331695 CCCCGTCAGCTCCCCAGGCAAGG - Intronic
928381737 2:30823940-30823962 GCCCCACAGGTCCCAAGGCAAGG - Intergenic
929877157 2:45806325-45806347 ACCCACCCGCTCCCCAAGCAGGG + Intronic
929938115 2:46309767-46309789 TCCCAACACCAGCCCAGGCCTGG - Intronic
931895423 2:66723676-66723698 TCCCAGCAGCTCAGGAGGCAGGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
932779824 2:74553279-74553301 ACCCAGCAGATTCCCAGGCAGGG + Intronic
933805688 2:85996864-85996886 CCCCTCCAGCTCCCCAGGCCTGG - Intergenic
933897446 2:86824573-86824595 TCCCCACAGGACCCCAGGAAGGG - Intronic
935325954 2:101936764-101936786 TCACAACTGCTCGCCAGCCAGGG + Intergenic
937845035 2:126570268-126570290 TCCCAACAGCTCCAGACACAAGG + Intergenic
938210047 2:129459565-129459587 TCCCTCCAGGTCCCCAGGGAAGG - Intergenic
938599552 2:132822671-132822693 TCACACCAGCTCCCCAGCAATGG + Intronic
938950346 2:136249381-136249403 TGCCCACAGCTCCCCAGCTAAGG - Intergenic
939223920 2:139340603-139340625 TCCTACCAGCTCCCTAGGGAGGG - Intergenic
939867433 2:147488630-147488652 TCCCTTCACCTCCCCAGGCTGGG + Intergenic
943524865 2:189004002-189004024 TCCCAGCGGTTCTCCAGGCAAGG + Exonic
946410849 2:219514529-219514551 TCCCAGCAGCTCCGCAGCCCTGG - Exonic
946691071 2:222308513-222308535 TCCCAACATCTCCCCTGCCTTGG - Intergenic
947669772 2:231928808-231928830 CCTCTGCAGCTCCCCAGGCAAGG - Intergenic
947725809 2:232399626-232399648 TCCTGCCAGCTCCCCAGGGATGG + Intergenic
948895845 2:240926501-240926523 TCCCAACAGCCCTCCAGCAAAGG + Intronic
1169253282 20:4076976-4076998 ACACCACACCTCCCCAGGCAGGG - Intergenic
1169506274 20:6214582-6214604 ACAAAACAGCTGCCCAGGCAAGG + Intergenic
1169979113 20:11363849-11363871 TCGCAACATCTCCCCAGCAAGGG - Intergenic
1171227511 20:23453513-23453535 TCCCATCAGGTCCCCAGGATGGG - Intergenic
1172275669 20:33677591-33677613 CTCCAACAGCTCACAAGGCAGGG + Intronic
1172391982 20:34571793-34571815 TCCCAACAGGTCCAAAGGCAAGG + Intronic
1173637720 20:44575568-44575590 ACCCAGCAGCTTCCCAGGCAGGG - Intronic
1175567117 20:59989106-59989128 TCCCAACAGGGTCCCAGGCCTGG - Exonic
1175964555 20:62654060-62654082 TCCCACCAGCTCCGGAGGCCAGG + Intronic
1176235210 20:64050636-64050658 CCCCAGCAGCCCTCCAGGCAGGG + Intronic
1177185016 21:17783763-17783785 TCCCAATAGCTCCCCCGATATGG + Intergenic
1180837166 22:18935655-18935677 ACCCAGCAGCTTCCCAGACACGG - Intronic
1180921343 22:19523103-19523125 CTCCAGCATCTCCCCAGGCAAGG - Exonic
1180982285 22:19884504-19884526 TGCCAACAGCTCCCCATGAAGGG - Intronic
1181038866 22:20182578-20182600 TCCCAGCTGCTCCCCTGACACGG + Intergenic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1182300772 22:29335710-29335732 GCCCATCTGCTCCCCAGGCTTGG + Intronic
1182302259 22:29343546-29343568 TCCCATTGGCTGCCCAGGCAGGG - Intronic
1183354407 22:37350668-37350690 TCCCATCAGCACCCCAGGGTGGG + Intergenic
1184175640 22:42787336-42787358 TCCCAACAGCACCCTAGTAATGG + Intergenic
1184341787 22:43890152-43890174 TCCCAACTGCTACACAGGCAAGG - Intronic
1184662794 22:45973055-45973077 TCCAAAGAGGTGCCCAGGCAGGG - Intronic
1185192630 22:49448176-49448198 TCCCACCAGCACCTCAGTCAAGG - Intronic
1203287259 22_KI270734v1_random:160954-160976 ACCCAGCAGCTTCCCAGACACGG - Intergenic
949463786 3:4322819-4322841 TCCCAGTAACTCCCCTGGCATGG + Intronic
952385198 3:32836111-32836133 CCCCGACAGCTCCCCCAGCAAGG + Intronic
952809279 3:37387029-37387051 TCTAAACAGCTTCACAGGCAAGG + Intronic
953415288 3:42712185-42712207 CCCCAACCCCTCCCCAGCCAAGG - Intronic
953988576 3:47465474-47465496 TTCTAACAGCTGGCCAGGCACGG + Intronic
956030638 3:65033623-65033645 CCCCAACACCTCTCCTGGCAGGG + Intergenic
956622928 3:71239251-71239273 ACCAAAAAGCTGCCCAGGCACGG + Intronic
956724080 3:72142725-72142747 CCCCAAGAGCTTCCCAAGCATGG + Intergenic
962250452 3:133833019-133833041 TCCCACCAGCTCCCAAGGTGTGG - Intronic
964457572 3:156885311-156885333 TCACACCAGCTCCCCAGCAATGG - Intronic
966344907 3:178968507-178968529 CCCCAACCTCTCCACAGGCAGGG + Intergenic
966724414 3:183096661-183096683 TCCCAGCAGCTCCTCATGGATGG - Intronic
967052043 3:185793859-185793881 ACCTTACTGCTCCCCAGGCAGGG - Intronic
967954797 3:194869819-194869841 CCACAGCAGCTCCCAAGGCAGGG - Intergenic
969712453 4:8851833-8851855 TCCCACCAGCAGCCCAGGCCTGG + Intronic
971364607 4:25967767-25967789 CTACAACAGCTTCCCAGGCATGG - Intergenic
971364819 4:25969218-25969240 CTACAACAGCTTCCCAGGCATGG - Intergenic
978759649 4:112343003-112343025 TCCCTTCAGCTCCCCAGTCCTGG + Intronic
979734679 4:124068627-124068649 TCCCCACATCTCCCCAGTCTTGG - Intergenic
980486291 4:133461588-133461610 TCCCAACACCTCCCCGGGGGAGG - Intergenic
980700325 4:136418904-136418926 TCCCACCATCTCCTCAGCCAAGG + Intergenic
980937786 4:139242641-139242663 TCCCAGCAGCTCTCCTGGCAGGG + Intergenic
981594847 4:146408255-146408277 GACCAACAGCTAGCCAGGCACGG + Intronic
983329164 4:166302171-166302193 TCACACCAGCTCCCCAGCAATGG + Intergenic
985589137 5:755750-755772 CCCCAACTCCTCCGCAGGCAGGG - Intronic
985603816 5:848266-848288 CCCCAACTCCTCCGCAGGCAGGG - Intronic
991960015 5:72035053-72035075 TGCAGACAGCTCCCCAGGCCTGG + Intergenic
991967674 5:72108296-72108318 TCCCAGCATCTCCCCGGGGAGGG - Intronic
993320695 5:86465353-86465375 TCCCAGCCGCTCCCCAGGCCTGG + Intergenic
994774241 5:104024395-104024417 TCCCAACTGCCCACCAGTCAAGG + Intergenic
997240535 5:132303506-132303528 TCCCATCAGCTTCCAAGGAAGGG + Intronic
997366853 5:133331195-133331217 TCCCAAGACACCCCCAGGCAGGG + Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
999192989 5:149762609-149762631 TCCAAATAGCCTCCCAGGCAGGG + Intronic
1001329056 5:170749425-170749447 TCCAGAGAGCTCCCCAGGGAGGG + Intergenic
1001591565 5:172869080-172869102 TCCCTCCAGCTCCCCACGCAAGG - Intronic
1001683552 5:173576168-173576190 TGCCACCAGATCCCGAGGCAGGG - Intergenic
1002332399 5:178453431-178453453 TTACAACAGCACCACAGGCACGG - Intronic
1005495015 6:26380850-26380872 TCCCAACAGCTGCCCAGTCCTGG + Intergenic
1009045810 6:58236715-58236737 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1009221624 6:60991028-60991050 ACCCAATAGCTCCCCAGCAATGG - Intergenic
1010348496 6:74841859-74841881 TTCCCACAGCTTCTCAGGCATGG - Intergenic
1011275068 6:85622581-85622603 ACAAAACAGCTGCCCAGGCAAGG - Exonic
1013457307 6:110342277-110342299 TCCCAACAGCTCCCCAGGCATGG - Intronic
1014191981 6:118506592-118506614 CCCCACCAACTCCCCAGGCAAGG - Intronic
1019437528 7:1029733-1029755 CCACACCATCTCCCCAGGCAGGG - Intronic
1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG + Intronic
1020014394 7:4822345-4822367 CCCCGCCAGCACCCCAGGCAGGG - Intronic
1020525388 7:9251931-9251953 TCCCAACACCTCTCCAGCAAGGG + Intergenic
1022284605 7:28943462-28943484 CTCCAACAGCTCCCCACTCAGGG + Intergenic
1023160247 7:37289958-37289980 TCCCAACAGATCTGGAGGCAAGG - Intronic
1023917357 7:44599736-44599758 TCTCAACAGCTGGCCAGGCATGG + Intergenic
1024143406 7:46485182-46485204 TCCCAACACCACCCCCCGCATGG + Intergenic
1024294169 7:47829745-47829767 GCCCAACTACTCACCAGGCATGG + Intronic
1025030872 7:55555630-55555652 TATCAAGAGCTCCTCAGGCATGG + Intronic
1027172338 7:75881606-75881628 TCCCTACACTTCCCCAGGCCTGG - Intronic
1028459305 7:91072630-91072652 TCGCAACAGCTCTCCAGCAATGG + Intronic
1030113073 7:106042765-106042787 TCCTGCCAGCCCCCCAGGCAGGG - Intergenic
1030256650 7:107516960-107516982 TCGCAACAGCTCTCCAGCAAGGG + Intronic
1035015116 7:155758926-155758948 GCCCAAGAGCTTCCCAAGCAGGG + Intronic
1035056940 7:156041914-156041936 TCCCCACAGCTCTGCCGGCAAGG - Intergenic
1035232290 7:157472534-157472556 TCCCTCCCTCTCCCCAGGCACGG - Intergenic
1035559739 8:595251-595273 GCCCAACAGCTCTGCAGCCAAGG - Intergenic
1036966331 8:13302161-13302183 TTCAAAAAGCTTCCCAGGCAAGG - Intronic
1037670690 8:21012884-21012906 TCCCAACAGGACTCCAGTCAAGG - Intergenic
1038048968 8:23791315-23791337 TCCCAACATCTCCAGAGGCCTGG + Intergenic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1039447864 8:37646924-37646946 TCCCACCAACTCTCCAGGTAAGG - Intergenic
1040442757 8:47461943-47461965 TCACACCAGCTCACCAGGAAGGG - Intronic
1042165558 8:65942509-65942531 ATCCAACAGATCCCCAGGCCTGG + Intergenic
1042584837 8:70324597-70324619 TCCCAAAAGCTCACGAGCCATGG + Intronic
1042712178 8:71730442-71730464 TCCCAAAATCTCACCTGGCAGGG + Intergenic
1046771394 8:118119961-118119983 TTCTAACAACTTCCCAGGCAAGG + Intergenic
1049227880 8:141466356-141466378 CCCCATCCTCTCCCCAGGCAGGG - Intergenic
1049537812 8:143190084-143190106 TCCCCTAAGCTCCCCAGTCAGGG + Intergenic
1049619788 8:143592892-143592914 TCCCAAGAGCTCCCCTTTCAGGG - Intronic
1050133803 9:2440877-2440899 TCACACTAGCTCCCCAGCCATGG - Intergenic
1051262298 9:15276398-15276420 TCCCAACAGCTTCCTAGGGTGGG - Intronic
1051946902 9:22580473-22580495 CTCCACCAGCTCCCCAGCCATGG - Intergenic
1052436773 9:28439686-28439708 TCCTGAGGGCTCCCCAGGCATGG + Intronic
1053002762 9:34586327-34586349 TCCCTACCCCTCCCCAGCCAGGG + Intronic
1054724694 9:68638804-68638826 TCCCACCACCTCCCCAGTGAAGG + Intergenic
1056763484 9:89430489-89430511 AGCCAACATCTTCCCAGGCAGGG + Intronic
1057006550 9:91565900-91565922 TCCCATCCCCTCCCCAAGCATGG + Intronic
1059407775 9:114112564-114112586 TCCCAAGGGCCCCTCAGGCAGGG - Intergenic
1060185367 9:121560898-121560920 TCCTAATGGCTCTCCAGGCATGG + Intergenic
1060509821 9:124223649-124223671 GGCCACCAGTTCCCCAGGCAGGG - Intergenic
1060825034 9:126683057-126683079 TCCCGACAGCGCCCCTGGCGCGG + Intronic
1061391432 9:130319311-130319333 TCCCAAGAGCTCTCCAGGGGTGG + Intronic
1061626083 9:131841516-131841538 GCCCAGCAGGACCCCAGGCATGG - Intergenic
1185648450 X:1631590-1631612 CCCAAGCTGCTCCCCAGGCAGGG - Intronic
1187095214 X:16140803-16140825 TCCAAACAGACCCCGAGGCAAGG - Intronic
1189497491 X:41522154-41522176 TCCCAGCAGCCTCCCAGGAAAGG - Intronic
1189663147 X:43325547-43325569 TCACACCAGCTCCCCAGCAATGG - Intergenic
1192157749 X:68759069-68759091 CCCAGACAGCTCCCCAGGCTGGG + Intergenic
1193164211 X:78263381-78263403 TCACAACACCTCCCCAGCAAGGG - Intergenic
1193346712 X:80412195-80412217 TCCCAGCTGCTCCCCAGCCATGG - Intronic
1193549930 X:82879294-82879316 TCCCAGCACTTCACCAGGCAGGG + Intergenic
1194103496 X:89737864-89737886 TCACAGCAGCTCCCCAGCAATGG - Intergenic
1194448909 X:94017852-94017874 TCCCAAGGCCTCCCCAGACATGG + Intergenic
1198264903 X:134999998-135000020 TCCCAAGCCCTCCCCAGGTAAGG + Intergenic
1198312424 X:135435496-135435518 GCCCGCCAGCTCCCCAGTCAGGG - Intergenic
1199566399 X:149220323-149220345 CCCCAAAAGCTCTCCAGCCAAGG + Intergenic