ID: 1013458418

View in Genome Browser
Species Human (GRCh38)
Location 6:110353504-110353526
Sequence AAAAACCATATGGCAAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 1, 2: 1, 3: 45, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013458418 Original CRISPR AAAAACCATATGGCAAAATT TGG (reversed) Intronic
900880666 1:5379051-5379073 AAAATCCATTTGTTAAAATTTGG - Intergenic
902971862 1:20059444-20059466 AAAGACCATATGGCCATTTTAGG + Intronic
905469889 1:38183811-38183833 TAAAAACATATGCCATAATTAGG - Intergenic
905497932 1:38409727-38409749 AAAAACAATATTTCAAAATATGG + Intergenic
906411929 1:45585223-45585245 TAAAAAAATATGGCAAGATTGGG - Intronic
906781764 1:48579077-48579099 AAAATCCAAATGGAAAAGTTTGG - Intronic
906836730 1:49091389-49091411 AACAACCATATTGAAAAATTGGG + Intronic
907227478 1:52961608-52961630 AAAGAACATATGGAAAAATATGG + Exonic
907954932 1:59218992-59219014 AAAGACCATATGTCCAAATAAGG + Intergenic
908043241 1:60138587-60138609 AAAAAGCATAGGCCTAAATTTGG - Intergenic
908696631 1:66849737-66849759 AAAAACCAAATGGAAATTTTAGG + Intronic
909009084 1:70312910-70312932 AAAAAATCTAGGGCAAAATTAGG + Intronic
909083554 1:71145634-71145656 AGCAACTATATGCCAAAATTTGG - Intergenic
909276461 1:73693157-73693179 TAAAACCATATTGCTAAATTAGG + Intergenic
910154162 1:84194143-84194165 AATAACCATAAGGCAATATGAGG - Intronic
910363491 1:86438836-86438858 AAAAAGAAAATGGCAACATTTGG - Intronic
910420730 1:87059165-87059187 AAAAAACGTATGGCAATTTTAGG - Intronic
910905166 1:92168402-92168424 AAAAATCATATTTTAAAATTAGG + Intronic
911202151 1:95056266-95056288 AATTTCCATATGGCAAAATAGGG - Intronic
911269506 1:95783142-95783164 ACAAACCATTTTACAAAATTGGG + Intergenic
911719689 1:101177504-101177526 AAAAACCACATGACAAAAAGAGG - Intergenic
911865887 1:103021254-103021276 AAATATCATATGACACAATTTGG + Intronic
911959304 1:104280097-104280119 AAGCACAAAATGGCAAAATTTGG + Intergenic
912781215 1:112550013-112550035 AAAAAGCATTTGACAAAATCTGG - Intronic
912849768 1:113112946-113112968 AAAATACATAGGGCAAAATTAGG + Intronic
915685735 1:157630944-157630966 GAAAAACATATGCCAAAATGTGG - Intergenic
917499213 1:175570820-175570842 AAAAACATTATGGAAATATTTGG - Intronic
918564712 1:185915379-185915401 AAAAAGCAGAGGACAAAATTTGG - Intronic
918886832 1:190204439-190204461 AAAAACTAGATGGAAAAACTAGG + Intronic
918952604 1:191159064-191159086 AAAAACCATATGATAATTTTGGG + Intergenic
919040673 1:192383857-192383879 AAAAAGCATTTGACAAAATTCGG + Intergenic
919378079 1:196818575-196818597 AAAAATTTAATGGCAAAATTTGG - Intergenic
919387766 1:196942613-196942635 AAAAATTTAATGGCAAAATTTGG - Intronic
919523005 1:198612478-198612500 AAAAACTATCTGACAAAAGTTGG - Intergenic
921144198 1:212336561-212336583 AAAAACTGTATGCCAAATTTTGG - Intronic
923749213 1:236731791-236731813 AAAAACAATATGTGAAAGTTTGG - Intronic
924787692 1:247214382-247214404 AAAAACCATAAGGCAAAAAAGGG - Intergenic
1063028663 10:2209193-2209215 AAGAAACATATTGCCAAATTTGG + Intergenic
1063572047 10:7224441-7224463 ATGAACCATATTACAAAATTTGG - Intronic
1063799358 10:9555382-9555404 AAAAACCATTTAGGAAAATTGGG - Intergenic
1065033328 10:21610748-21610770 ACACTCTATATGGCAAAATTTGG - Intronic
1066223923 10:33363773-33363795 AAAAGCCCTATGGCTACATTTGG + Intergenic
1067194071 10:44099165-44099187 AAAATACATAGGGCAAAATTTGG + Intergenic
1068130428 10:52889313-52889335 AAAAACCAAAAGCCAAAAATAGG - Intergenic
1068418335 10:56755694-56755716 AAAGACCTTATTGAAAAATTTGG - Intergenic
1068605564 10:59001253-59001275 AGAAACAGTATGGCAGAATTGGG + Intergenic
1068910724 10:62375381-62375403 AAATACCATTTGGCATAAGTGGG - Intronic
1069212334 10:65778331-65778353 ATAAAACATATGCAAAAATTGGG - Intergenic
1070295687 10:75159395-75159417 AAAAAGAATTAGGCAAAATTTGG - Intronic
1070895235 10:79978074-79978096 AAAAACCAAAAGGCAAAAAATGG - Intronic
1071280069 10:84093532-84093554 AAAGGCCATATGGAAATATTTGG - Intergenic
1071584203 10:86803403-86803425 AAAAACCATAAAGAAAAATGTGG - Intronic
1072381202 10:94872700-94872722 AATAATAAAATGGCAAAATTTGG - Intergenic
1072810170 10:98455385-98455407 AAAAACAGTGTGGCAAAACTAGG - Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1073762528 10:106645578-106645600 AATAAGCATATGAAAAAATTCGG - Intronic
1076101364 10:127781785-127781807 AAATAACATGTGTCAAAATTAGG - Intergenic
1076255840 10:129024183-129024205 ACAAACTATATGGCAAGATCAGG + Intergenic
1076343907 10:129767600-129767622 AATAACCATTTGCCAAGATTTGG + Exonic
1078786937 11:14503703-14503725 AAAAACCATAATCCAAAATTTGG - Intergenic
1079487545 11:20951324-20951346 AGTAACCATATGAGAAAATTTGG - Intronic
1079939867 11:26666354-26666376 ACTAACCATATGCCAAAATAAGG - Intergenic
1082318926 11:50772209-50772231 AAAAACCAGATAGAAACATTGGG - Intergenic
1082818786 11:57529578-57529600 CATAACCATTTGGCAAATTTGGG - Intronic
1085003228 11:73060680-73060702 AAAAACTATAAGACAAAAATGGG + Intronic
1085657837 11:78332936-78332958 AATAAATATTTGGCAAAATTAGG - Intronic
1086752110 11:90509608-90509630 AGAAAACATATGTCAAAATGTGG - Intergenic
1087450612 11:98317202-98317224 AAACTGAATATGGCAAAATTAGG - Intergenic
1087466372 11:98511627-98511649 AAAAACCATAAGGCATAACAAGG - Intergenic
1088198844 11:107307516-107307538 AAAAGGCATATGGCAAAACTTGG - Intergenic
1088606341 11:111537320-111537342 GAAAACCACTTAGCAAAATTTGG + Intergenic
1091164173 11:133456477-133456499 AAAAAAAAAATGGCAAAATATGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093604212 12:21070254-21070276 AAAAAGCATTTGACAAAATCAGG - Intronic
1094178613 12:27567321-27567343 AAAAACCATTTGTTTAAATTAGG - Intronic
1094626130 12:32125882-32125904 AAAAAAAAAATGCCAAAATTAGG + Intronic
1094772742 12:33684403-33684425 AAAAATCAGTTTGCAAAATTAGG - Intergenic
1095973148 12:47918874-47918896 AATAATCATATAGCAATATTTGG + Intronic
1096621849 12:52870199-52870221 AGAAACCATATGAAAAAATGAGG + Intergenic
1096691288 12:53323528-53323550 AACAACCATATGAAATAATTAGG - Intronic
1097560108 12:61192854-61192876 AAAAAGCATATGGCTACATAGGG - Intergenic
1097607417 12:61772635-61772657 AAAAAGCATTTGACAAAATCTGG + Intronic
1099879717 12:88453790-88453812 TAAAACTAAATGGCAAGATTAGG + Intergenic
1099963489 12:89419440-89419462 AAAAACTATGTGGCAACATCAGG + Intergenic
1100313799 12:93424187-93424209 AAAAACCATACGGCATAAACAGG + Intronic
1101025412 12:100599308-100599330 AATAATCATATTTCAAAATTTGG + Intronic
1103670790 12:122613542-122613564 AACTACCATATGGAAATATTAGG - Intronic
1105903251 13:24776811-24776833 AAAAAAGATGTGGCAACATTGGG - Intronic
1105988939 13:25598957-25598979 AAAAACCATAGGGAACACTTGGG - Intronic
1106197538 13:27507271-27507293 GAAATCCATCTGGAAAAATTTGG + Intergenic
1108856633 13:54800535-54800557 AAAAACCATATGATTACATTGGG - Intergenic
1108950214 13:56083262-56083284 AGAAACCATATTTCAAATTTTGG - Intergenic
1108990337 13:56648435-56648457 AAAAACCATCTGGCATGGTTTGG + Intergenic
1110016488 13:70411996-70412018 AAACAACAGATGGGAAAATTTGG - Intergenic
1110114804 13:71799685-71799707 CAAAACCACATGGCCAGATTTGG - Intronic
1110629190 13:77686704-77686726 AAAAAGCATTTGATAAAATTTGG + Intergenic
1110781404 13:79469911-79469933 AAAAATCATATTACAAAATAGGG - Intergenic
1111078265 13:83267068-83267090 AAAAACTATATTTCAAAAATGGG - Intergenic
1111255958 13:85669195-85669217 AAAAAAAAAAAGGCAAAATTAGG + Intergenic
1111301026 13:86350633-86350655 AAGAACTATATTGAAAAATTAGG + Intergenic
1111762699 13:92485535-92485557 ACAGTCCATATGGCAAAATTAGG + Intronic
1111800987 13:92980592-92980614 ACAAACAATATAGAAAAATTTGG + Intergenic
1115579540 14:34744480-34744502 AAGAACCAAATGGAAAATTTAGG - Intergenic
1116300709 14:43178477-43178499 AAATGCCAAATGTCAAAATTTGG + Intergenic
1116923710 14:50610483-50610505 GAAAACCATATGGCAAAATTTGG + Intronic
1117235343 14:53768732-53768754 AAATCACATATGCCAAAATTCGG + Intergenic
1117724416 14:58658544-58658566 AAAAAGCAAGTGGCAAAATTCGG - Intergenic
1117839055 14:59838795-59838817 AAAAACCATATGTAATATTTTGG + Intronic
1118683913 14:68271907-68271929 AAAAAGAAAATGGCAAATTTGGG - Intronic
1119417579 14:74484167-74484189 AAAAAACAAATGGCATCATTAGG + Intronic
1120222562 14:81751020-81751042 AATAAATATATTGCAAAATTAGG + Intergenic
1120546735 14:85820891-85820913 AAAATCCAAATGTCAAAATGTGG + Intergenic
1122611761 14:102988999-102989021 AAAAAACAAATGGCAAATTGGGG + Intronic
1123673377 15:22683413-22683435 CAAAAGCATTTGACAAAATTCGG - Intergenic
1125176721 15:36831036-36831058 TAAAACGAAATGGCAAAATCAGG + Intergenic
1125559998 15:40622786-40622808 AAAAGCAAAATGTCAAAATTTGG + Exonic
1126642655 15:50843228-50843250 AAAAAGCATTTGACAAAATCCGG + Intergenic
1126668777 15:51096922-51096944 AAAAAAGTAATGGCAAAATTTGG + Intronic
1127014799 15:54672249-54672271 AAAAAGCATTTGACAAAATCCGG + Intergenic
1127501614 15:59559146-59559168 AAAAACCAAATGGCATAGCTGGG + Intergenic
1127560126 15:60127917-60127939 AAAAACCATAGGGCAGAGTCAGG - Intergenic
1127740806 15:61902621-61902643 AAAAAGCGTTTGACAAAATTTGG + Intronic
1128133692 15:65247374-65247396 AAAATCCATATGGCAGAGCTGGG + Intronic
1128413256 15:67420129-67420151 ACAAACCAAATAGAAAAATTAGG + Intronic
1130695844 15:86130499-86130521 AAAATCATTATGGAAAAATTAGG + Intergenic
1130802841 15:87284012-87284034 AAAAAGCATTAGACAAAATTTGG + Intergenic
1131604545 15:93887428-93887450 AAATACCAAATGGGAAAAGTGGG + Intergenic
1131995570 15:98129641-98129663 AAAAACGATGTGGGAAAAGTAGG + Intergenic
1133408670 16:5549604-5549626 TAAAACCAGATGGGAAAAATTGG + Intergenic
1136345476 16:29672917-29672939 AAAATCCAGATGGCAAGATTTGG + Intronic
1136624906 16:31456503-31456525 AAAAAAAAGATGGTAAAATTTGG + Intergenic
1138446436 16:57067047-57067069 TAAATCCATATGGCACAGTTTGG + Intronic
1138869466 16:60864363-60864385 CAAGACCATAAGGCAAAATGGGG + Intergenic
1138881610 16:61022833-61022855 GAAAACAAAATGGCAAACTTTGG - Intergenic
1138988189 16:62357437-62357459 CAAATCAATATGTCAAAATTAGG + Intergenic
1139687152 16:68612887-68612909 GAATACCTAATGGCAAAATTTGG + Intergenic
1141875729 16:86822923-86822945 ACAAACCATACGGTAAAATGTGG - Intergenic
1145278104 17:21448009-21448031 AAACAATATATGGCAACATTGGG - Intergenic
1145315928 17:21733892-21733914 AAACAATATATGGCAACATTGGG - Intergenic
1145714353 17:27005820-27005842 AAACAATATATGGCAACATTGGG - Intergenic
1147027134 17:37596597-37596619 AAAAACAGTATGGCCTAATTGGG + Intronic
1148187473 17:45655067-45655089 ATAAACCATAAAGCAAATTTGGG - Intergenic
1149386585 17:56148641-56148663 AAAAAAAAAATGGCAAAACTTGG + Intronic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1150021787 17:61622814-61622836 AAAAAACATAGGAGAAAATTTGG - Intergenic
1150855387 17:68747310-68747332 AAAAACCATATTACAGAATTTGG + Intergenic
1151083120 17:71351426-71351448 GAAAAATATATGGCAAATTTCGG - Intergenic
1153080469 18:1217887-1217909 ACAAACCATATGGCTACACTGGG - Intergenic
1153123108 18:1755560-1755582 AAAATACATAAAGCAAAATTTGG - Intergenic
1153322442 18:3786304-3786326 AAAAACCAAATGGGAGCATTTGG - Intronic
1153702438 18:7710321-7710343 AAAAAGCATTTGACAAAATCTGG + Intronic
1154114800 18:11603963-11603985 AAAAAACATATAACAAAATAAGG + Intergenic
1154393227 18:13962183-13962205 AAAAACCATAAGGAAAATTCTGG - Intergenic
1155087448 18:22472127-22472149 AAAAACCAGATGGCAGAAAATGG + Intergenic
1155246038 18:23910042-23910064 AAAGAGCATAAGGCAAAGTTTGG + Intronic
1156004438 18:32422728-32422750 AAACAACATATGTAAAAATTTGG + Intronic
1156234717 18:35191175-35191197 AAAATCCATATGGTAAGATAGGG - Intergenic
1156515834 18:37679515-37679537 ACAAACCACAAGGCCAAATTGGG - Intergenic
1156621833 18:38861555-38861577 TAAAAACATTTGCCAAAATTTGG + Intergenic
1156853410 18:41754833-41754855 AAAAACGATTTGGCTAAATCAGG + Intergenic
1157102158 18:44741073-44741095 AAAAACTTTAAGGCAAAAATTGG + Intronic
1157263329 18:46195194-46195216 CAAAAACAAATGGCAAAATGTGG - Intronic
1157654083 18:49368471-49368493 CAAACCCATATGGAAAAATGTGG - Intronic
1157658734 18:49419815-49419837 AAAAACCATATACTATAATTTGG + Intronic
1158034247 18:53005361-53005383 AATATCCATATAGGAAAATTTGG - Intronic
1158373356 18:56833686-56833708 AGAAACTATATAGCAAAATGAGG - Intronic
1158816750 18:61107978-61108000 AAAAGACATTTGACAAAATTTGG + Intergenic
1158884023 18:61808174-61808196 AAATACCATATATTAAAATTGGG + Exonic
1158923295 18:62219835-62219857 TAAAAATATATGGAAAAATTAGG - Intronic
1159178909 18:64875443-64875465 AGAAATCATATGGGATAATTGGG + Intergenic
1159193102 18:65073997-65074019 ATAAATCATATTTCAAAATTTGG + Intergenic
1159209060 18:65292272-65292294 AAACACTCTATTGCAAAATTAGG + Intergenic
1159410571 18:68070310-68070332 AAGAATCATATGACATAATTGGG + Intergenic
1159839506 18:73381956-73381978 ATAAGTTATATGGCAAAATTGGG + Intergenic
1161132757 19:2601278-2601300 AAAAACCATGGGGCACAAGTAGG + Intronic
1162650242 19:12083056-12083078 AAAAAAGATAAGGCAAAAATGGG - Intergenic
1162696067 19:12476767-12476789 AAAAACCATTTGGTAAAAGGAGG - Intronic
1163146355 19:15381497-15381519 AAAAACCATAAGGTAAAAGAAGG + Intronic
1164439825 19:28266609-28266631 AAAAAGCATTTGACAAAATCTGG + Intergenic
1165656924 19:37541851-37541873 AAAAACCCAATAGCAAAATGTGG + Exonic
1165983128 19:39742786-39742808 AAAAAGCATTTGACAAAATCCGG - Intergenic
1166813953 19:45530456-45530478 AAAAACCACTTGTAAAAATTGGG - Intronic
1167401882 19:49278259-49278281 AAAAGCCATTTGGCAAAATGCGG + Intergenic
925214078 2:2078242-2078264 AACAAGAATATGGCAAAAATAGG + Intronic
925458130 2:4036344-4036366 AAAAACCATAGAGCAAAAAAAGG - Intergenic
925502751 2:4524054-4524076 AAAAACCAGATGGCACCAATAGG + Intergenic
926490800 2:13523952-13523974 AAAAATCATATGGAAAATTAAGG + Intergenic
926910860 2:17851481-17851503 AAAAAGCATCTGGCAAATTTGGG + Intergenic
926917105 2:17902871-17902893 AAAAAGTACATGGAAAAATTGGG - Intronic
926938001 2:18105246-18105268 AAAACACAAATGGCAGAATTGGG - Intronic
927312219 2:21644086-21644108 AAAAAATATTTGGCAATATTTGG - Intergenic
927529965 2:23787646-23787668 AAAAAGAATATGGAAAAATAAGG + Intronic
927804342 2:26132623-26132645 AATAACCAAATAGAAAAATTGGG - Intronic
928482996 2:31702594-31702616 AAAAAGCATTTGACAAATTTTGG + Intergenic
928631870 2:33201815-33201837 ATAAGCCTTAGGGCAAAATTGGG + Intronic
929006995 2:37405333-37405355 ACAAACCATATTAAAAAATTGGG - Intergenic
929227899 2:39529231-39529253 AAATAACATATGTGAAAATTTGG + Intergenic
930213850 2:48672479-48672501 AAAAAGCAAATGGTAAAAGTGGG + Intronic
930765228 2:55078402-55078424 AAAAATAATATGGCAAAACTAGG - Intronic
931045871 2:58352359-58352381 GAAGACCAAAAGGCAAAATTAGG - Intergenic
931100174 2:58990319-58990341 AAAAATCATCTGTCACAATTCGG - Intergenic
931106085 2:59057411-59057433 AAAAACCACTTAGCATAATTTGG - Intergenic
931956410 2:67430877-67430899 TAAAACCACAGGGTAAAATTCGG - Intergenic
932076092 2:68664273-68664295 AAAAACAAAATGGCAAATTCTGG + Intergenic
932583937 2:73010653-73010675 AAATCCCAAATGGCAAAATTTGG + Intronic
933053841 2:77636075-77636097 AAAATTAATATGGCTAAATTTGG + Intergenic
933441205 2:82316641-82316663 AAAATCCATATGACAAATTTAGG - Intergenic
933907562 2:86910343-86910365 AAAAATCTTATGGGAAAATAGGG + Intronic
933908807 2:86920035-86920057 AAAAATCTTATGGGAAAATAGGG + Intronic
934023919 2:87983350-87983372 AAAAATCTTATGGGAAAATAGGG - Intergenic
936692478 2:114907096-114907118 AAAAACTGTAAGTCAAAATTAGG - Intronic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
936729684 2:115365660-115365682 AAATACCTTATGGCAAAGTAAGG - Intronic
937850615 2:126630633-126630655 AAAAAGCATTTGACAAAATCTGG + Intergenic
939743434 2:145938538-145938560 TAAAAGAATATGGCAATATTTGG - Intergenic
939753031 2:146072627-146072649 AAACATCATAAGGCAAAACTGGG - Intergenic
940069322 2:149667507-149667529 AAAAACCACTTTCCAAAATTGGG - Intergenic
940416701 2:153431248-153431270 AAAAAAGAAAGGGCAAAATTAGG - Intergenic
940460292 2:153956085-153956107 AAAAACCAAAAGCCAAAATGAGG + Intronic
941071339 2:160958029-160958051 AAAAACCATATGACAGTAATGGG - Intergenic
941198777 2:162483378-162483400 AAAGACCATGTAGCAAAATATGG - Intronic
941253095 2:163191679-163191701 AAAAACCTAAAGGCAAAATTAGG - Intergenic
941386936 2:164865104-164865126 AAATACCATTTAGCAAAATTTGG - Intergenic
941530142 2:166659186-166659208 AAAAACCATTTCACAAAATGAGG + Intergenic
941538138 2:166746214-166746236 AAGAATCCTATGACAAAATTAGG + Intergenic
941564711 2:167092265-167092287 AAAATGAATATGGCAAAATGTGG - Intronic
942121329 2:172780617-172780639 AATAACCATATGGCATATTTTGG + Intronic
942179675 2:173368162-173368184 TAAAACCATGTGGAAAAATTAGG + Exonic
942336766 2:174896453-174896475 AAAAAGCATATGGTGACATTTGG + Intronic
942825072 2:180165670-180165692 AAAAACAATATGGAAGTATTAGG - Intergenic
942852062 2:180499191-180499213 AAACACAATATATCAAAATTCGG + Intergenic
942947872 2:181689188-181689210 AAAAACCATACCACAAAACTAGG - Intergenic
943184627 2:184591760-184591782 AAAATTCAGATGGCAATATTTGG - Intergenic
943320737 2:186439272-186439294 AAAAACAACATGACAAATTTAGG - Intergenic
943989745 2:194672723-194672745 TTTAACCATGTGGCAAAATTGGG - Intergenic
944012760 2:194994029-194994051 TAAAACCATATGGAATAAGTAGG + Intergenic
944438160 2:199713931-199713953 CAAAACCTAATGGCAAAACTGGG + Intergenic
945501529 2:210581538-210581560 AAAAACCAATTTTCAAAATTAGG + Intronic
945600105 2:211851332-211851354 AAAAATTATATGTCAAAAATAGG + Intronic
945690688 2:213031311-213031333 ATAAAACAAATGGCAATATTTGG - Intronic
945755212 2:213837406-213837428 AAGGACCATTTGGCATAATTGGG - Intronic
945846021 2:214945740-214945762 ACAAACTATAGGGCAAGATTAGG + Intronic
946051508 2:216866633-216866655 CAAAATCATAAGGGAAAATTTGG - Intergenic
946531537 2:220576055-220576077 AAAAACCATAAACCAAAACTTGG - Intergenic
946562782 2:220931549-220931571 CAAAACCAGAAGGCAAAAGTAGG + Intergenic
946714319 2:222537152-222537174 CAAAACCATTTGGAAAAATTAGG + Intronic
947138548 2:226999479-226999501 AAAAAGCACATGGCAAGATTCGG - Intergenic
947182441 2:227423457-227423479 AAAAATTAGATGACAAAATTAGG - Intergenic
947776816 2:232718930-232718952 AGAAAAAATATGGCAAAATTTGG - Intronic
947957504 2:234206182-234206204 TAGACCCATATGGGAAAATTTGG + Intergenic
1170039980 20:12029695-12029717 AAGTACCAGATGGCATAATTTGG + Intergenic
1172612718 20:36263650-36263672 AAAAAGCAAATGGCAAACTGGGG - Intronic
1173129071 20:40370674-40370696 AAAAACCATTTGGCCAAACTAGG + Intergenic
1173458128 20:43220221-43220243 AAAAATCATATGCCAACGTTGGG + Intergenic
1176701093 21:10050836-10050858 AGAAACTATATGGCTAAATGTGG + Intergenic
1177319479 21:19501345-19501367 ACAAACCATATGACTCAATTGGG + Intergenic
1177963691 21:27700806-27700828 GACTAGCATATGGCAAAATTTGG - Intergenic
1178221513 21:30665883-30665905 GGAATCCTTATGGCAAAATTGGG - Intergenic
1178721134 21:35010163-35010185 CAAAACCATATTGCATATTTTGG + Intronic
1180088369 21:45519305-45519327 AAAAACGAAATGGCAGACTTAGG + Intronic
1180944665 22:19685457-19685479 AAAAAGCATTTGACAAAAATCGG + Intergenic
1181138373 22:20785655-20785677 AAAAACCAAATGCCTAAAATTGG + Intronic
1181736431 22:24885289-24885311 AATAAGCATAAGGCAAAAATGGG + Intronic
1182400184 22:30069829-30069851 AAACACAATGTAGCAAAATTAGG + Intergenic
949623524 3:5843727-5843749 AAAAACCAGATGGAAGAATTTGG - Intergenic
950528073 3:13536207-13536229 CAAAACCATATGCCAACATGTGG - Intergenic
950963130 3:17126432-17126454 AAGAAACATTTGGCAACATTTGG - Intergenic
951108420 3:18772342-18772364 TTAAACCATTTGACAAAATTGGG + Intergenic
951483154 3:23183142-23183164 AAAAAAAAAAAGGCAAAATTGGG + Intergenic
952772467 3:37014651-37014673 AGAAACCTCATGGCAAAGTTTGG + Intronic
953039980 3:39247597-39247619 AAAAGCTATAGGGGAAAATTTGG + Intergenic
953125178 3:40086045-40086067 AAAAACCCTATGAATAAATTAGG + Intronic
953567555 3:44045936-44045958 ACAAACCATATGAAAAAATAGGG + Intergenic
953739677 3:45526864-45526886 AAAAACCAAATGTCCAAAATGGG + Intronic
954782095 3:53069455-53069477 AAAAACCATAGTGGAAAAATGGG + Intronic
955422162 3:58749552-58749574 AACAACCATATGGGAATATTTGG + Intronic
955554461 3:60120919-60120941 ATAAACCTAAAGGCAAAATTTGG - Intronic
955653915 3:61223660-61223682 ATACACCATCTGGCAAAATGTGG - Intronic
956063451 3:65372087-65372109 AAAATCCATTTGGAAAGATTTGG - Intronic
958202025 3:90333257-90333279 AAAAACGAGATGGAAACATTCGG - Intergenic
958444582 3:94199444-94199466 AAAAAGCATTTGACAAAATACGG - Intergenic
958547314 3:95571240-95571262 AAACACCAGAAGTCAAAATTAGG + Intergenic
958687673 3:97420851-97420873 AAAAAAAATAGGGCCAAATTTGG + Intronic
959670611 3:108972927-108972949 AAAAACCAAAGGAGAAAATTGGG + Intronic
960402733 3:117223469-117223491 AAACACCCTATTGTAAAATTAGG + Intergenic
960493273 3:118344420-118344442 AAAAACCATGTGCCAAGATATGG - Intergenic
962516215 3:136154681-136154703 AAACACCACATATCAAAATTTGG + Intronic
964466930 3:157003928-157003950 AAAAAACAGATGGGAAAAATAGG + Intronic
964728950 3:159844628-159844650 AAAAACCATTTAGAAAAATGTGG - Intronic
964797830 3:160519058-160519080 AAAATCCATATGGAAATATAAGG - Intronic
964935327 3:162077524-162077546 AAAAACCATTTAAAAAAATTTGG - Intergenic
964948178 3:162251540-162251562 AAAAACCATATTCTAGAATTTGG + Intergenic
965648683 3:170910193-170910215 AAAAACAATAGGGAAAAGTTAGG - Intergenic
966476625 3:180356075-180356097 AAAAACCTTATTGCCAAATAAGG + Intergenic
966781516 3:183588330-183588352 ACAAACTATATGGAAAAAATTGG + Intergenic
967318843 3:188176016-188176038 AAAATCAGAATGGCAAAATTGGG + Intronic
968310028 3:197675526-197675548 AAAACACAGATGGCAAAATGAGG + Intronic
969165073 4:5300999-5301021 AAAAAGCATTTGATAAAATTTGG - Intronic
970115534 4:12690804-12690826 GAAAGCCATATGTCTAAATTTGG - Intergenic
970736219 4:19171509-19171531 TAAAAACATCTGGCAAAAATAGG - Intergenic
971439209 4:26661613-26661635 AAAACCCAAATAGCCAAATTAGG + Intronic
971787026 4:31117711-31117733 AAAAACCATTTGCCATATTTAGG + Intronic
971796242 4:31232522-31232544 AAAAACTAAATTGCAAAATGGGG - Intergenic
971861224 4:32108397-32108419 AAAATCCATATGGTAGAGTTTGG + Intergenic
972470704 4:39401230-39401252 AAACACAATATGGCAAAATGTGG + Intergenic
972866133 4:43235514-43235536 AAACACCAGATGTCAATATTAGG - Intergenic
973033547 4:45375358-45375380 AAAAATACTATAGCAAAATTTGG - Intergenic
974198987 4:58614322-58614344 AAAGATCATATGGCACTATTGGG + Intergenic
974216724 4:58856729-58856751 AAAAACCATAGGAGAAAATTAGG - Intergenic
974761474 4:66280931-66280953 AAAGACCATAAGGTAAAAATAGG - Intergenic
974826314 4:67135124-67135146 AAAAATCAAATGGAAAAAATAGG - Intergenic
974857724 4:67480720-67480742 AAAAAGCATTTGCCAAAATCCGG + Intronic
974971081 4:68828257-68828279 AAAAACCATAAAAAAAAATTAGG - Intronic
974981082 4:68957925-68957947 ATAAACCTTATGCCAAATTTTGG - Intergenic
975111540 4:70634074-70634096 ACAAACCAAAAGGCAGAATTAGG - Intronic
975144163 4:70949488-70949510 GAAAGCCAAATGGCAACATTTGG + Intronic
975693351 4:76987230-76987252 AAAAACCATATGGTAATACAAGG - Intronic
976274978 4:83267032-83267054 GAAAATCAGATGGGAAAATTTGG + Intronic
976880330 4:89914693-89914715 GAATACCATATCACAAAATTAGG - Intronic
976899892 4:90159515-90159537 ACACACAATATGGAAAAATTAGG + Intronic
978752572 4:112268058-112268080 AAAAACTACATTGCTAAATTTGG + Intronic
979211446 4:118109265-118109287 AAAACCACCATGGCAAAATTAGG + Intronic
980019692 4:127693789-127693811 AAAAAGCATTTGACAAAATCCGG - Intronic
980036905 4:127895325-127895347 TAAAAACAAATGGCAAAAGTAGG - Intronic
980212790 4:129811479-129811501 AACTAACATCTGGCAAAATTTGG - Intergenic
980240854 4:130173031-130173053 AAAAAACTAAAGGCAAAATTTGG - Intergenic
980486720 4:133466972-133466994 AAAAAGCAGAAGGCAAATTTCGG - Intergenic
982503396 4:156188256-156188278 AAAAACTATATGGTAACATATGG + Intergenic
983531245 4:168811898-168811920 AAAAACCATATCAAAATATTGGG + Intronic
984368091 4:178823976-178823998 AAAAACCATCTGACTAAACTTGG + Intergenic
984782979 4:183542621-183542643 AACCAACATATGGAAAAATTAGG - Intergenic
985356055 4:189120586-189120608 AAAAAGCATTTGACAAAATCCGG + Intergenic
986141545 5:5035235-5035257 GAAATCCATATGGCAACATATGG - Intergenic
986267730 5:6204854-6204876 AAAAATCATATTGCAAAAGGGGG - Intergenic
986651567 5:9968878-9968900 AAAAAGCATTTGATAAAATTTGG + Intergenic
986951448 5:13090818-13090840 AAAAACAATATGCCAAAACCTGG + Intergenic
987582306 5:19810027-19810049 AAAAACTAGATGTCAAAATGAGG + Intronic
987763791 5:22198908-22198930 AAAAAGCAGATAGGAAAATTCGG + Intronic
987899520 5:23993559-23993581 AAAAACAATATGTCAAAAACAGG + Intronic
988225682 5:28408736-28408758 AAAAACCAAAAGCCAAAATAAGG + Intergenic
988371597 5:30376570-30376592 AGAAACCAGAGGGCAGAATTTGG + Intergenic
988680411 5:33479682-33479704 AAAACCCATATATCAACATTTGG + Intergenic
988876225 5:35449430-35449452 AAAAAGCATCTGACAAAATCCGG + Intergenic
989363360 5:40628402-40628424 AAAAACCAAATAGAAAAGTTTGG - Intergenic
990055608 5:51573230-51573252 AAAAACCACATAACAAACTTGGG - Intergenic
990335940 5:54772838-54772860 AAACACCATCTGCCAAAGTTGGG + Intergenic
990762720 5:59148268-59148290 AAAAATTATATTGCAAAAGTGGG + Intronic
990793494 5:59512055-59512077 AAAAACCAGATGTTAAGATTGGG - Intronic
990871724 5:60439172-60439194 AAATACCTTATGGCTTAATTAGG + Intronic
991219018 5:64190629-64190651 AAAAACCTTATCTCCAAATTGGG - Intronic
991898513 5:71431988-71432010 AAAAAGCAGATAGGAAAATTCGG + Intergenic
992586640 5:78246995-78247017 AAAAACCACATATCAAAGTTTGG - Intronic
992847591 5:80767654-80767676 ATAAACCATATAGCAAAAATAGG - Intronic
993538429 5:89117717-89117739 CAAAATCATCTGGCAAAATAGGG + Intergenic
993934138 5:93980227-93980249 TAAAACCATAATTCAAAATTAGG - Intronic
994748693 5:103711381-103711403 AAGAACAATATAGCAAAAGTTGG - Intergenic
995915037 5:117235168-117235190 CAAAACCAGATGCAAAAATTAGG - Intergenic
996108528 5:119536801-119536823 AAAAACCATATGACATTAGTAGG + Intronic
996742574 5:126814523-126814545 AAAAACCAACTTGCAAAAATGGG - Intronic
1000078437 5:157819018-157819040 AAAAACCATATAGCAAAAGTGGG - Intronic
1001352053 5:170978526-170978548 AAAAACTACATGCAAAAATTTGG + Intronic
1001856411 5:175014360-175014382 AAAAAGCAGATGCCAGAATTTGG + Intergenic
1002009888 5:176270731-176270753 AAACAACACATGGCAGAATTTGG + Intronic
1002790455 6:433888-433910 AAAAACCCTACGTCAAAAGTAGG + Intergenic
1003421457 6:5961900-5961922 AAAAAGCAAGTGGAAAAATTTGG + Intergenic
1003695508 6:8402857-8402879 AAAAACCATATACCAAGACTTGG + Intergenic
1005585259 6:27270161-27270183 TAAAACCATGTGGGAAACTTAGG + Intergenic
1005830541 6:29667687-29667709 AAAAACCAAAAGGCAAGAATTGG - Intronic
1008355325 6:50546124-50546146 TAAAAATATATGGCAGAATTGGG + Intergenic
1008934839 6:56979604-56979626 AAAAACCATCTTGCTTAATTGGG - Intronic
1008936247 6:56995763-56995785 AAAAACCCTATGTCCAAATAAGG + Intronic
1009670103 6:66738246-66738268 AAAACTCATAAGCCAAAATTTGG - Intergenic
1010413252 6:75584852-75584874 AAAAACTATATTGGAAAGTTTGG - Intergenic
1010453785 6:76031398-76031420 ATTAACAATATGGCAGAATTGGG - Intronic
1010743387 6:79534012-79534034 AAAAACCATATTGCTACATTTGG + Intronic
1010833472 6:80558022-80558044 AACAACCAAATGGTAGAATTGGG - Intergenic
1010919234 6:81661167-81661189 AAAAAGGATAAGGCTAAATTGGG - Intronic
1011034988 6:82963860-82963882 AAGAACCATAGGGCAGAATCTGG + Intronic
1011260706 6:85466732-85466754 AAAAACAACATGGAAAAATTGGG + Intronic
1011271765 6:85587211-85587233 AAAAAAAATATGGCAAAATATGG + Intronic
1011891850 6:92173663-92173685 AAAAATCATATGTTAAAATTGGG + Intergenic
1012564145 6:100624885-100624907 AAAATCAATTTTGCAAAATTTGG - Intronic
1012835355 6:104257627-104257649 AAAAACACTGTGGCAAATTTAGG + Intergenic
1013458418 6:110353504-110353526 AAAAACCATATGGCAAAATTTGG - Intronic
1014598069 6:123370253-123370275 AAAACCCATATAGAAAAATAAGG - Intronic
1014639120 6:123887440-123887462 TAAAACCAGATGGAAAAATCAGG + Intronic
1015348164 6:132184035-132184057 AAAAAGCATTTGACAAAATCCGG + Intergenic
1015885992 6:137919326-137919348 TAAAACCATATGGCCAGAGTGGG + Intergenic
1016024242 6:139269544-139269566 AAAAACAATTTGGGAAAATGAGG + Intronic
1016416456 6:143839453-143839475 AAAAAACAGATGGCTAAACTAGG + Intronic
1016586426 6:145691857-145691879 AAAAATAAAATGGCAAACTTAGG + Intronic
1017072803 6:150591127-150591149 AAAAACAATGTGACAATATTGGG - Intergenic
1017225441 6:152015826-152015848 AAATTCCAAATGGCGAAATTTGG - Intronic
1017226226 6:152024315-152024337 AAAAATCAAAGGGCAATATTTGG - Intronic
1017351680 6:153450090-153450112 AAGAACCATATGGAAAAATGTGG + Intergenic
1017642901 6:156511584-156511606 TAAGACTAGATGGCAAAATTAGG - Intergenic
1018248156 6:161841908-161841930 AAATACAATAAGGAAAAATTGGG - Intronic
1020483832 7:8696428-8696450 AAATGCCATATGACAATATTAGG + Intronic
1021122002 7:16806483-16806505 AAAAACCATGTGGCAATACAGGG - Intronic
1022633722 7:32111040-32111062 ATAAACCAGATGGCAAAACAGGG + Intronic
1022981313 7:35607304-35607326 AAAATCCATGTGGCAAAAGTAGG + Intergenic
1023613504 7:41995057-41995079 AAAATCCAGGTGGCAAAATTTGG - Intronic
1024203967 7:47137312-47137334 AAAATCAATATATCAAAATTTGG - Intergenic
1024712853 7:52036775-52036797 AAAACCTAGATGGGAAAATTTGG - Intergenic
1024847520 7:53664805-53664827 AAAAAGCATTTGACAAAATTTGG - Intergenic
1027592364 7:80133693-80133715 AAAAATCATTTGGGAAAACTGGG - Intergenic
1028151796 7:87382227-87382249 AACAACCATATGTAAAAATTTGG + Intronic
1028268225 7:88755354-88755376 AAAAACCATATTTCCAAATAAGG + Intergenic
1028659143 7:93248261-93248283 AAAAATTACAAGGCAAAATTGGG - Intronic
1028927540 7:96375356-96375378 TAAAACAATATGTCAGAATTTGG - Intergenic
1029916655 7:104216627-104216649 AAAAGCCAGATGGAAAAATAAGG + Intergenic
1031404406 7:121367359-121367381 AAAAACCAGTTGGCAGGATTTGG - Intronic
1031412767 7:121459606-121459628 AAAAACCATATAGCATAAAATGG + Intergenic
1032107028 7:129040930-129040952 AAGAATCATTTGGCAAACTTGGG + Intronic
1033081196 7:138299329-138299351 AAAAAACACTTGACAAAATTCGG - Intergenic
1033260029 7:139835552-139835574 AAAAAGCATTTGACAAAATCTGG + Intronic
1034482242 7:151331262-151331284 AAAAGACAAATGGCAAAATGGGG + Intergenic
1035841556 8:2817320-2817342 AAAATTGATATGGCATAATTTGG + Intergenic
1036073301 8:5466453-5466475 TACAAACATATGGTAAAATTTGG + Intergenic
1036218941 8:6904278-6904300 TAAGACCAGATGGCAAAATGTGG + Intergenic
1038537680 8:28365477-28365499 CAGAACCATATGGCAAACTAGGG - Intronic
1038694529 8:29794330-29794352 AAAAACCACATTAAAAAATTAGG - Intergenic
1038704634 8:29882023-29882045 AGAAACCATCTGTGAAAATTAGG + Intergenic
1038860009 8:31376480-31376502 AAATAACATAAGGCAAAAATTGG - Intergenic
1039730949 8:40276855-40276877 AAAAAGCATTTGACAAAATTAGG - Intergenic
1039780901 8:40784340-40784362 AAAAATCATTTGACAAAATCCGG + Intronic
1040410454 8:47149049-47149071 AAAAAACAAAAGGAAAAATTAGG + Intergenic
1040711267 8:50191994-50192016 AAAAACAATATGGTGATATTTGG - Intronic
1041296366 8:56361331-56361353 ACAAACAAGATGGCAAAAGTTGG - Intergenic
1042264128 8:66891493-66891515 AAAAACCCTCTCGGAAAATTAGG - Intronic
1042289155 8:67149669-67149691 AAAAACAATAGGACAAAGTTGGG - Intronic
1042383913 8:68151112-68151134 AAAAACCCTATTTCAAAATAAGG + Intronic
1042609549 8:70582694-70582716 AAAAACCATAAGGAAAAAAGAGG + Intronic
1043730281 8:83669352-83669374 AAAAAGCAAATGTCAACATTAGG - Intergenic
1044106406 8:88212502-88212524 AAAGAACATATGACAAATTTAGG + Intronic
1044498833 8:92927430-92927452 AAAAAACAAATAACAAAATTTGG + Intronic
1044674639 8:94717311-94717333 AAAGACAATTTGGGAAAATTTGG + Intergenic
1045060914 8:98410129-98410151 AAAAACCAGCTGGCTAAAATCGG + Intronic
1045204661 8:100025740-100025762 AAAAACTTTATGGCATAAGTGGG - Intronic
1045466251 8:102472909-102472931 AAAAATAAAATGGCAAAGTTAGG + Intergenic
1045485374 8:102627337-102627359 AGAAACCAGATGGAAAAATAAGG + Intergenic
1045934730 8:107665706-107665728 AAAAAACATATGGCAAATATTGG + Intergenic
1045986543 8:108255894-108255916 CAAAACCATATGGGGAAACTTGG + Intronic
1046390882 8:113570961-113570983 AAAAACCATTTTTAAAAATTCGG + Intergenic
1046504564 8:115120706-115120728 AAAAGGTATATGGGAAAATTTGG + Intergenic
1047064390 8:121264086-121264108 AAAAAGCATATGGCAGAAAAGGG - Intergenic
1047514731 8:125544369-125544391 AAAATCCATGTGTCATAATTGGG + Intergenic
1047578140 8:126181270-126181292 AAAGACCATGTGGGAAAAATAGG - Intergenic
1048202642 8:132388955-132388977 AAAAACATTCTGGAAAAATTTGG + Intronic
1050359538 9:4816486-4816508 AAAAACCACCTGATAAAATTTGG - Intronic
1050389386 9:5122667-5122689 AAATAACATAAAGCAAAATTAGG + Intronic
1050458813 9:5859362-5859384 AAGAACCATATAGGATAATTAGG + Intergenic
1050498894 9:6273218-6273240 TAAAAAAATATGGCTAAATTTGG + Intergenic
1051152709 9:14101025-14101047 AAATAACATATGGAAATATTAGG + Intronic
1051166909 9:14272252-14272274 AAAAGCCAGATTGAAAAATTGGG - Intronic
1051475612 9:17505106-17505128 AAAAAGCATGTGACAAAAATTGG + Intergenic
1051797435 9:20888497-20888519 AAGAACCATTTTGTAAAATTTGG - Intronic
1053638237 9:40037335-40037357 AGAAACTATATGGCTAAATGTGG + Intergenic
1053767848 9:41427885-41427907 AGAAACTATATGGCTAAATGTGG - Intergenic
1054546513 9:66339389-66339411 AGAAACTATATGGCTAAATGTGG - Intergenic
1055072899 9:72185743-72185765 AAACACCAGATGGCAAATTTGGG - Intronic
1055225804 9:73993373-73993395 AACAAGCTTATGGCAAACTTTGG - Intergenic
1055261621 9:74442653-74442675 AAAGATAATATGGCAAAAGTTGG + Intergenic
1055858281 9:80718162-80718184 AAAAAAGATATGGTAAAACTAGG - Intergenic
1056449260 9:86699644-86699666 AAGAATGATTTGGCAAAATTTGG + Intergenic
1056934532 9:90905805-90905827 AAAGACATTATGGCAAAAATGGG + Intergenic
1057420468 9:94908120-94908142 AAAAACCAGAGGGAAACATTAGG - Intronic
1058247786 9:102652565-102652587 CAAAACCACATGGAAAAATGAGG - Intergenic
1059781510 9:117533115-117533137 AAAGACCATATTCCAAATTTAGG - Intergenic
1059949450 9:119446894-119446916 AAAAAGTATATCTCAAAATTTGG + Intergenic
1202786107 9_KI270719v1_random:20893-20915 AGAAACTATATGGCTAAATGTGG + Intergenic
1186648007 X:11527855-11527877 AAAGACCATAATGCAAAATAAGG - Intronic
1187706547 X:22014970-22014992 AAAAATCAGATGGCAGAATCTGG + Intergenic
1189591459 X:42516984-42517006 AAAAACCAAATCTCAAGATTTGG - Intergenic
1190138446 X:47818569-47818591 AAAAAGCATTTGACACAATTTGG + Intergenic
1192385572 X:70665432-70665454 AAAAATAATATAGCAAAATCAGG + Intronic
1192788851 X:74360072-74360094 AACAAGCATTTGACAAAATTCGG + Intergenic
1193327552 X:80197804-80197826 AAAAAACAAATGACAGAATTTGG + Intergenic
1194116634 X:89907452-89907474 ACAATCTATATGGCAAAATATGG + Intergenic
1194686880 X:96930441-96930463 AAAACCCAAATTGCAAAAGTGGG - Intronic
1196154410 X:112411628-112411650 AGAAAGCATATGATAAAATTCGG + Intergenic
1196337648 X:114557525-114557547 ATAAACCATATGGGATTATTTGG - Intergenic
1196662626 X:118283427-118283449 GAAAATCATATGGCAAAAACAGG - Intergenic
1197947263 X:131852577-131852599 AAAAAGCATTTGTCAAAATTTGG - Intergenic
1198208562 X:134493789-134493811 AAAAACCAAATGTTAATATTAGG - Intronic
1198695894 X:139337488-139337510 AAAAAGCATTTGACAAAATTCGG - Intergenic
1200469432 Y:3564624-3564646 ACAATCTATATGGCAAAATATGG + Intergenic
1200876509 Y:8161152-8161174 AACATCCACATGGCAAAACTAGG - Intergenic
1201485259 Y:14487135-14487157 AAAAACAACATAGAAAAATTTGG - Intergenic
1202099560 Y:21293099-21293121 AAAAACAATTTGGCAACATAGGG + Intergenic
1202270245 Y:23065217-23065239 AAAAATTATAGGGCAATATTTGG - Intergenic
1202295782 Y:23355465-23355487 AAAAATTATAGGGCAATATTTGG + Intergenic
1202423239 Y:24698962-24698984 AAAAATTATAGGGCAATATTTGG - Intergenic
1202447550 Y:24971124-24971146 AAAAATTATAGGGCAATATTTGG + Intergenic