ID: 1013462632

View in Genome Browser
Species Human (GRCh38)
Location 6:110389910-110389932
Sequence GGGCAGGTTGCTGCAGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013462624_1013462632 15 Left 1013462624 6:110389872-110389894 CCTGTGTTGTTTATTGTAGATAA No data
Right 1013462632 6:110389910-110389932 GGGCAGGTTGCTGCAGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013462632 Original CRISPR GGGCAGGTTGCTGCAGCTTG TGG Intergenic
No off target data available for this crispr