ID: 1013462636

View in Genome Browser
Species Human (GRCh38)
Location 6:110389963-110389985
Sequence CTGAATGTACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013462636_1013462638 15 Left 1013462636 6:110389963-110389985 CCATTGTCCATTTGTACATTCAG No data
Right 1013462638 6:110390001-110390023 ATAAAGACAGATAGCTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013462636 Original CRISPR CTGAATGTACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr