ID: 1013464563

View in Genome Browser
Species Human (GRCh38)
Location 6:110406474-110406496
Sequence CTGTAGAAACAGAGAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 2, 2: 8, 3: 64, 4: 566}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013464563 Original CRISPR CTGTAGAAACAGAGAGTAGA TGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902618087 1:17634812-17634834 CTGTTGGAACAGAGAGGACAAGG - Intronic
904891089 1:33780146-33780168 CTGGAGATACAAAGAGTGGAAGG - Intronic
905590281 1:39157332-39157354 TTGTAAAAACAGAGAGAAAAGGG - Intronic
905682919 1:39887193-39887215 CTATAGAAACAAAGAGAACAGGG + Intergenic
906343094 1:44997981-44998003 CCATAGAGATAGAGAGTAGAAGG + Intergenic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
906827948 1:49001923-49001945 ATGAAGAAACAGAGAGTTAAGGG - Intronic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
908325605 1:63020523-63020545 GTGTAGAAGCAGAGAACAGAGGG + Intergenic
908644835 1:66266015-66266037 CTGTGGAGACAGAGAAAAGAAGG - Intronic
908965777 1:69760658-69760680 CTATAAAAATATAGAGTAGAGGG + Intronic
909154371 1:72052993-72053015 TAATAGAAACAGAGAGTAGTAGG - Intronic
910243960 1:85119367-85119389 TCGTAGATACAGAAAGTAGATGG - Intronic
910253337 1:85221126-85221148 CTGGAGAAACACAGAGTATTTGG + Intergenic
910276573 1:85455637-85455659 CTGAAGAAATGGAGAGTAAATGG - Intronic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
910533147 1:88264288-88264310 CAGTAGAGCCAGTGAGTAGAGGG - Intergenic
910691562 1:89970684-89970706 ATGTAAAGACAGAGAGAAGATGG + Intergenic
911370635 1:96990748-96990770 ATGTAGAAACTGACAGTTGAAGG - Intergenic
911485948 1:98505249-98505271 GTGTAGAAACAGTGAGTTGTGGG - Intergenic
911581708 1:99641776-99641798 CTGTAGAAAGAGCCTGTAGAAGG - Intergenic
911815014 1:102338044-102338066 TTTTAGTTACAGAGAGTAGAAGG + Intergenic
912114522 1:106388717-106388739 TGGGAGAAACAGAGACTAGAAGG - Intergenic
912764637 1:112396966-112396988 CAGAAGGAACAGAAAGTAGAAGG - Intronic
914423249 1:147549515-147549537 CTGGACAATCAGAGAATAGAAGG + Intronic
914741584 1:150470538-150470560 CTGTAGAAACAAAGATTAGAGGG - Intronic
916287033 1:163119183-163119205 TTATAGAATTAGAGAGTAGAAGG + Intronic
916468342 1:165094685-165094707 GTGTAGAAACTGTGAGTTGAGGG - Intergenic
916786799 1:168092440-168092462 CTGCATAAACACAGAGGAGAGGG - Intronic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917542431 1:175927233-175927255 CTGAAGCAAGAGAGAGGAGAAGG + Intergenic
917706719 1:177642203-177642225 ATGTAGAAACACAGATAAGAAGG - Intergenic
918797552 1:188922186-188922208 CAGTAGAAACAGAGTGTAAAAGG - Intergenic
918959645 1:191256981-191257003 TTATAGAGACAGAAAGTAGAAGG + Intergenic
919166071 1:193894984-193895006 ATGCAAAAACAGAGAGGAGAAGG - Intergenic
919272383 1:195364605-195364627 TTGTGGACATAGAGAGTAGAAGG + Intergenic
920953064 1:210591234-210591256 TTGTGGAGACAGAGAGTAAAAGG - Intronic
921032070 1:211342684-211342706 TTATGGAGACAGAGAGTAGAAGG - Intronic
921098546 1:211908655-211908677 TCATAGAAACAGAGAGCAGAGGG - Intergenic
921372589 1:214439934-214439956 CAGAAGAAACAAAGGGTAGAGGG - Intronic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
924039376 1:239969099-239969121 TCAAAGAAACAGAGAGTAGAAGG + Intergenic
924450802 1:244177239-244177261 TCATAGAAACAGAGAGTAGGAGG - Intergenic
924551127 1:245078629-245078651 TCATGGAAACAGAGAGTAGATGG + Intronic
1062963454 10:1590704-1590726 TCATAGAAACAGAGAGCAGAAGG + Intronic
1064319412 10:14288809-14288831 TCATAGAAACAGAGAGTAGAAGG - Intronic
1064419193 10:15175929-15175951 TCATAGAGACAGAGAGTAGAAGG + Intergenic
1064507192 10:16045172-16045194 CTCTAGGAAAAGAAAGTAGATGG + Intergenic
1064514833 10:16135749-16135771 GAGTAGAAATGGAGAGTAGAGGG + Intergenic
1065734865 10:28742503-28742525 TCGTAGAAACAGAAAGTAGGGGG + Intergenic
1067332599 10:45335247-45335269 CTGTGGAAACAGTGAGTAGAAGG - Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1068032283 10:51718734-51718756 CCATAGAGACAGAGAGTAGAAGG + Intronic
1068725987 10:60304067-60304089 CTATAGAAACAGAGAGTAGAAGG + Intronic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070507098 10:77123544-77123566 ATGTAGAAACGTGGAGTAGAAGG + Intronic
1070568865 10:77625545-77625567 TCATAGAAACAGAAAGTAGAAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070933326 10:80275762-80275784 GTGTAGAAACACAGAGTAGAAGG - Intronic
1071102112 10:82050793-82050815 CTGGAGAGACAGAGAGTAGGAGG - Intronic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071923791 10:90381752-90381774 CTATAGAAACAGACAGCAGTGGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1073959083 10:108905142-108905164 GAGTAAAAACAGAGAGAAGAGGG + Intergenic
1074213996 10:111366315-111366337 CAGAAAAAACAGAGAATAGATGG - Intergenic
1074567241 10:114591430-114591452 CTGTAGAAACAAATATTAAATGG + Intronic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1074679257 10:115887444-115887466 CTGTAACAACACACAGTAGAAGG + Intronic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075084067 10:119402390-119402412 CTGTAGAACTGGAGGGTAGAAGG - Intronic
1075508131 10:123044238-123044260 CTGTGGAAAAACAGCGTAGAGGG + Intronic
1076285613 10:129293258-129293280 TCATAGAAATAGAGAGTAGAAGG + Intergenic
1076578503 10:131490425-131490447 CTGCAGAGCCAGAAAGTAGATGG + Intergenic
1078548060 11:12260694-12260716 TTTTAGAAGAAGAGAGTAGAAGG + Intronic
1079685976 11:23360462-23360484 CTGTGGGAACAGAGTGTAGAGGG - Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1082294426 11:50421483-50421505 GTGTAGATACATAGATTAGATGG + Intergenic
1082716612 11:56621572-56621594 TCATAGAAACAGAGAATAGAAGG + Intergenic
1084353589 11:68622184-68622206 CTATAGAGACAGACAATAGAGGG + Intergenic
1084470171 11:69354855-69354877 CTGTAGAGGGATAGAGTAGAAGG + Intronic
1086245888 11:84752428-84752450 GTGTAAGAAGAGAGAGTAGAAGG + Intronic
1086438782 11:86807608-86807630 CTGTAGAAACAAAGACAAGCAGG - Intronic
1086450192 11:86907911-86907933 TTGTAGGAGCAGAGAATAGATGG - Intronic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1086821706 11:91443608-91443630 CAGGAGAAAGAGAGAGTAAAGGG + Intergenic
1086854282 11:91847903-91847925 CTATTGAAACTGAGACTAGAAGG + Intergenic
1086934380 11:92728794-92728816 AGGAAGAAACAGAGATTAGAGGG - Intronic
1087012869 11:93529957-93529979 CTTTGGAGACAGTGAGTAGATGG - Intronic
1087243170 11:95803409-95803431 CTCCAGAAAAAGAAAGTAGAGGG + Intronic
1087459412 11:98425829-98425851 CCACAGAAACAGAGAGTATAAGG - Intergenic
1087603654 11:100347371-100347393 TTGTGGAAACAGAGAAAAGAAGG - Intronic
1088376473 11:109146866-109146888 CTTTAGAACCAGAGACTACATGG + Intergenic
1090365858 11:126204883-126204905 GTATAGAGACAGAAAGTAGATGG - Intronic
1091301665 11:134511804-134511826 CTTGAGAAACAAAGAGGAGATGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1093800019 12:23361882-23361904 CTGTCGGAACATAGGGTAGAAGG - Intergenic
1094185487 12:27638012-27638034 TTTTAGAGACAGAAAGTAGAAGG + Intronic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1096153644 12:49330166-49330188 CTGTTGAGACAGGAAGTAGAGGG + Exonic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1098047713 12:66419258-66419280 ATGGAGAGAGAGAGAGTAGAAGG + Intronic
1098194106 12:67981458-67981480 CTGTGGAAACTGTGAGTAAAAGG - Intergenic
1098263489 12:68695572-68695594 ATGTAGGGACAGAAAGTAGATGG + Intronic
1098773675 12:74586511-74586533 CCTATGAAACAGAGAGTAGAGGG - Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099507410 12:83496577-83496599 AAGTAGAATCAGAGAATAGATGG - Intergenic
1099924120 12:88996679-88996701 CTGTGGAAGGAGAGAGTAAAAGG - Intergenic
1100300042 12:93298486-93298508 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1100744928 12:97635304-97635326 CTGCAGGAACATAGAGAAGAAGG - Intergenic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101154543 12:101915313-101915335 CTTTAGTAAAAGAGGGTAGAGGG + Intronic
1101361696 12:104033456-104033478 TTACAGAAACAGAGAGTAGAAGG + Intronic
1102250924 12:111387050-111387072 CCATAGAGACAGAGAGCAGATGG - Intergenic
1102937371 12:116909164-116909186 CTGTAGAAAATTAGAGTATATGG - Intergenic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1104236120 12:126938075-126938097 CTGTAATAGCAGAGAGGAGAAGG + Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1108527307 13:51296857-51296879 CAGCAGAAAGAGAGAGGAGAGGG + Intergenic
1108973707 13:56409407-56409429 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109906722 13:68852798-68852820 GTATAGAAATTGAGAGTAGAGGG - Intergenic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1110747878 13:79077630-79077652 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1110848129 13:80213050-80213072 TCATAGAAACAGAGAATAGAAGG + Intergenic
1111364761 13:87227945-87227967 TCATGGAAACAGAGAGTAGAAGG - Intergenic
1111628971 13:90825830-90825852 CTGGAGAAAGAGAGAGCACAGGG + Intergenic
1111838298 13:93416730-93416752 CAGTGGACACAGAGAGTAGAAGG - Intronic
1111905847 13:94255431-94255453 CTATAGAAACAGGGAGGAAAAGG + Intronic
1112070769 13:95847203-95847225 GTGTAGGAACAGTGAGTATATGG - Intronic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1112471903 13:99696952-99696974 CTGTTGAAACAGAGAAGACAGGG - Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113486696 13:110658327-110658349 TCATAGAAACAGAAAGTAGAAGG + Intronic
1115015774 14:28611839-28611861 TTGTTGCAACAGAGAGTATATGG - Intergenic
1115071384 14:29326747-29326769 GAGTAGAAACAGTGAGGAGAGGG + Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115135000 14:30097246-30097268 CTATATAGATAGAGAGTAGAAGG + Intronic
1115376093 14:32677269-32677291 CTGTGGATACTAAGAGTAGAAGG + Intronic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116267958 14:42720416-42720438 ATGTAGAAACATAGCTTAGAAGG - Intergenic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1117788495 14:59313111-59313133 CTGTAGAAACATAGGCCAGAAGG - Intronic
1118003346 14:61543804-61543826 CAGTAGGAACAGAGAGTTTAGGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118147527 14:63156792-63156814 TTGTAGAAACAGAGAGTAGAAGG - Intergenic
1118260474 14:64242041-64242063 CTGTACAAACAAGGAATAGAAGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1118916351 14:70110369-70110391 CTATGGACATAGAGAGTAGAAGG - Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119980165 14:79071628-79071650 ATGGAGAGAGAGAGAGTAGAAGG + Intronic
1120918519 14:89731592-89731614 TCATAGAAACAGAAAGTAGAAGG - Intergenic
1121266419 14:92605211-92605233 ATGTAGAAATAAAGAGTAAATGG - Intronic
1121590314 14:95101303-95101325 CTGCAGAAATAAGGAGTAGAAGG + Intronic
1121910161 14:97782795-97782817 CTGTGGATACAGAGAGTAAATGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122654991 14:103252416-103252438 TCGTGGAGACAGAGAGTAGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123178652 14:106446137-106446159 CTGAAGAAAGAGAGAGGAGGTGG - Intergenic
1124077684 15:26461616-26461638 CTGTTGAAACAGAGCTCAGAGGG + Intergenic
1124424045 15:29548030-29548052 TCATAGAAACAGAAAGTAGAAGG + Intronic
1125456035 15:39859766-39859788 TCGTAGAGACAGAAAGTAGATGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1128159700 15:65415507-65415529 ACGTAGACACAGAGAGAAGACGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128692697 15:69737329-69737351 TTTTAGAAGCAGAGATTAGAGGG + Intergenic
1128920838 15:71608711-71608733 CAGTAGAAACAGAGATTAGAAGG - Intronic
1129828955 15:78654659-78654681 CTGTAGTTACAGACAGTATAGGG - Intronic
1130169084 15:81493346-81493368 TTGTTGAAACAGAGAGTATTTGG - Intergenic
1131363948 15:91821457-91821479 CTATAGAAACAAAGATAAGAAGG + Intergenic
1131919409 15:97307379-97307401 TCATAGAAACAGAGAGCAGAAGG - Intergenic
1131950019 15:97672037-97672059 TTGTGGACATAGAGAGTAGAAGG - Intergenic
1133384617 16:5358991-5359013 TCATGGAAACAGAGAGTAGAAGG - Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1135107758 16:19665360-19665382 CCATGGAGACAGAGAGTAGAAGG - Intronic
1135165939 16:20139200-20139222 GTGAAAAAACAGAGTGTAGAGGG - Intergenic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1136001236 16:27295405-27295427 CTATAGAGACAGAAAGTAGATGG - Intergenic
1137554677 16:49463118-49463140 CTGGAGAGACAGAGAAGAGAAGG - Intergenic
1137636973 16:49995451-49995473 CTTTAGAAACAGACAGTAACAGG - Intergenic
1137754643 16:50891730-50891752 CTCTAGAAACTGGGAGCAGAGGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138524136 16:57592165-57592187 TTGGATAGACAGAGAGTAGATGG - Intergenic
1138577814 16:57919719-57919741 CTCTAAAAACAGAGACCAGATGG + Intronic
1140121676 16:72089014-72089036 TTGAAGAAAAAGACAGTAGATGG + Exonic
1140997383 16:80274386-80274408 CTTTATAAACAGAGAGAAAAGGG - Intergenic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142880723 17:2880664-2880686 CCATAGAGACAGAAAGTAGATGG - Intronic
1143348893 17:6272201-6272223 CTGTAGGAACACAGAGAAAAGGG - Intergenic
1143415547 17:6746371-6746393 TTATAGAGACAGAGAGTAGAAGG + Intergenic
1144670042 17:17127730-17127752 CTGTAGCAGTACAGAGTAGAGGG + Intronic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146510096 17:33439526-33439548 CTGAAGAAGCAGGGAATAGAGGG - Intronic
1148236440 17:45972243-45972265 CTGAAGAAAGAGAGAGGAGGGGG - Intronic
1148791487 17:50175689-50175711 CTGTGGGAAGAGAGAGTGGAGGG - Intronic
1149241124 17:54650895-54650917 TCATAGAAATAGAGAGTAGAAGG - Intergenic
1149408553 17:56380291-56380313 CTTTAGAAACAGAGCCAAGATGG + Intronic
1150005965 17:61469179-61469201 CTCTAGAAAGTGAGAGCAGAGGG + Intronic
1152245257 17:79182116-79182138 CTGGAGAGAGAGAGAGTACAGGG - Intronic
1152559105 17:81068991-81069013 CCGTAGAAACAGACAGGACAGGG + Intronic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154235028 18:12597139-12597161 GTGTAGAAAGAGACACTAGAGGG - Intronic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1155874162 18:31064351-31064373 CTTTTAAAACAGAGACTAGAAGG - Exonic
1156022355 18:32614490-32614512 ATGTATAAACATAGATTAGAAGG - Intergenic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156906161 18:42354623-42354645 CTGAAGGAAAACAGAGTAGAAGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157653053 18:49356714-49356736 TGGTAGTAACAGTGAGTAGATGG - Intronic
1157851827 18:51061384-51061406 CCATAGAGACAGAGAGTAGAAGG - Intronic
1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG + Intergenic
1159426771 18:68299181-68299203 CTGTAGAAACTCAGAGTAGATGG - Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1168595622 19:57673703-57673725 TATTAGAAACTGAGAGTAGAAGG - Intronic
925073124 2:987177-987199 CTGTAGGAACTTAGAGGAGATGG + Intronic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
926173640 2:10569882-10569904 GCGTAGAAACAGAGAAGAGAAGG + Intergenic
926271607 2:11370970-11370992 CTGTAGAAACAGAGACCAGTTGG + Intergenic
926377707 2:12250148-12250170 CTCTTGAACCAGGGAGTAGAAGG - Intergenic
926852022 2:17209295-17209317 TCATAGAAACAGAGATTAGAAGG - Intergenic
927003218 2:18821442-18821464 CTCTAGAAGGAGAGAGGAGAAGG + Intergenic
927523791 2:23719665-23719687 GTGTAGAAACAGTGAGTTGGGGG - Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928475200 2:31618631-31618653 TCATAAAAACAGAGAGTAGAAGG + Intergenic
928488716 2:31758718-31758740 TCTTAGAGACAGAGAGTAGAAGG + Intergenic
929695238 2:44109039-44109061 TGGTAGCAACAGAGAGTTGAGGG - Intergenic
930531539 2:52594856-52594878 CTGTAGATACAGGGATCAGATGG + Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
931630553 2:64294760-64294782 TTGTAGAATCAGTGGGTAGATGG - Intergenic
931809486 2:65840960-65840982 AAGAAGAAGCAGAGAGTAGAGGG - Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932200233 2:69820214-69820236 TTGTAGAAACACAGAGGAAAGGG + Intronic
932266933 2:70375869-70375891 TCATAGAAACAGAGAGTAGAAGG - Intergenic
933113028 2:78428565-78428587 TCATAGAAACAGAGAGTAGACGG + Intergenic
933339135 2:80999173-80999195 ATGGAGATAGAGAGAGTAGAAGG - Intergenic
933949191 2:87313793-87313815 GTGTGGAAACAGAGAGAAGGCGG - Intergenic
934776368 2:96940202-96940224 CTGTGGAATCAGGGAGTAAAGGG + Intronic
935206705 2:100902513-100902535 TTATAGAGACAGAAAGTAGAAGG + Intronic
935468204 2:103425038-103425060 GTGAAGAAACACAGAGAAGATGG + Intergenic
935627839 2:105185701-105185723 CTGTAGAAAGAAAGACAAGAAGG + Intergenic
935789302 2:106576272-106576294 CGGTAAGAACAGAGAGGAGAAGG + Intergenic
936140536 2:109936235-109936257 GTGAAGACACAGAGAGGAGATGG + Intergenic
936177227 2:110234180-110234202 GTGAAGACACAGAGAGGAGATGG + Intergenic
936204158 2:110435251-110435273 GTGAAGACACAGAGAGGAGATGG - Exonic
936914067 2:117622181-117622203 CTGTAGCAACTCAGAGTAGGTGG + Intergenic
937278085 2:120698955-120698977 CTGTAGAAAGTGAGAAGAGAGGG - Intergenic
938799268 2:134745806-134745828 CTGTAGAAACTGTGAGTTGTGGG - Intergenic
938966680 2:136394778-136394800 CTGGAGGAACAGAAAGTACAGGG + Intergenic
938988786 2:136606553-136606575 TAATAGAAACAGAGGGTAGAAGG - Intergenic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
941512074 2:166424438-166424460 CTGTATCAACAAAGAGCAGATGG + Intronic
942312979 2:174672730-174672752 CTGCAGGAACAGGGAGAAGATGG - Intronic
942650327 2:178160173-178160195 TCATAGAAACAGAAAGTAGAAGG - Intergenic
942750568 2:179282323-179282345 CCATAGAGATAGAGAGTAGAAGG + Intergenic
942946923 2:181682540-181682562 CTGAAGATACAGACAGTACAGGG - Intergenic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
944078353 2:195757621-195757643 GTGTAGAAACAAAGAGGGGAAGG + Intronic
944150830 2:196556465-196556487 TCATAGAAACAGAGAGTAGAAGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945179095 2:207073800-207073822 CTGAAGACACAGGGAGTAGGAGG + Intergenic
945270357 2:207932243-207932265 CAGTAGAAACAAATAGTACATGG + Intronic
945316402 2:208375790-208375812 GTGTATAACCAGAGACTAGAGGG + Intronic
945711005 2:213294111-213294133 CTACAGAAACAGACATTAGAAGG - Intronic
946247874 2:218397693-218397715 CTGTAGAGACAGAGGGCAGCTGG + Intergenic
946391589 2:219419589-219419611 CTGGAGAAAAAGGGAGTAGGTGG + Intronic
946901450 2:224376755-224376777 CTATAGAAACATAAAGTAAATGG + Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947706698 2:232282099-232282121 CTGGAAAGACAGAGAGTAGGAGG - Intronic
947889770 2:233606740-233606762 CAGGAGAAAGAGAGAGTCGATGG + Intergenic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1168871195 20:1130124-1130146 TTGTAGAGACAGACAGTGGATGG + Intronic
1169295685 20:4395838-4395860 TCATAGAAACAGAGAGTAAAGGG - Intergenic
1170010941 20:11723434-11723456 GTGTAGATACAGAGCGGAGAAGG + Intergenic
1170273773 20:14559597-14559619 TTATAAAAACAGAAAGTAGAGGG - Intronic
1170863527 20:20131019-20131041 GTGTAGAAACTGTGAGTTGAGGG + Intronic
1170996799 20:21369093-21369115 TCGTGGAGACAGAGAGTAGAAGG - Intronic
1171131340 20:22656350-22656372 TCATAGAGACAGAGAGTAGAAGG - Intergenic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173762108 20:45571666-45571688 TTGTAGAAGTAGAGAGTAGATGG - Intronic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174312420 20:49668348-49668370 CTGTCTAAACAGATACTAGATGG + Intronic
1175039198 20:56029863-56029885 CTGTGGATACAGAGAAAAGATGG + Intergenic
1175683765 20:61011123-61011145 CTATAGAGAGAGAGAGGAGAAGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177312445 21:19414358-19414380 CTCTAGAAACAAAGAGTTGGGGG - Intergenic
1178935221 21:36856021-36856043 CCATAGAAACAGAAAGTAGATGG + Intronic
1179048391 21:37867688-37867710 CTGTAGAACCACACAGCAGATGG + Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1180888485 22:19266813-19266835 CAGTAGACACAGAAAATAGAAGG + Intronic
1180890020 22:19280906-19280928 CTATAGAGACAAAAAGTAGATGG + Intronic
1181621429 22:24094138-24094160 CTGCAGGAACAGAGAGGAGCTGG + Intronic
1182100365 22:27653531-27653553 CCATGGAGACAGAGAGTAGAAGG + Intergenic
1182206790 22:28635985-28636007 TCATAAAAACAGAGAGTAGAAGG - Intronic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182908667 22:33960762-33960784 CCGTGGAGACAGAGATTAGAAGG - Intergenic
1183030061 22:35097074-35097096 CAGCAGAAACAAAGACTAGAGGG - Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1185130907 22:49038082-49038104 CTGTAGAAAGACAGAGGAAACGG - Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
949189088 3:1230021-1230043 GTGTGGAAACAGAGAGTAAAGGG + Intronic
949323005 3:2832534-2832556 CTGAAGGACAAGAGAGTAGAAGG + Intronic
949809008 3:7985858-7985880 CTGTACACACAGCTAGTAGAGGG - Intergenic
950339798 3:12233090-12233112 TCGTAGAAACAGAAAGTAAATGG + Intergenic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
950945765 3:16944594-16944616 GTGAAGACACAGAGAGGAGATGG + Intronic
951061396 3:18211052-18211074 ATATAAAAACAGAAAGTAGATGG + Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952888632 3:38026914-38026936 TTGTAAAAACAGAAAATAGAGGG - Intronic
953189631 3:40671851-40671873 GCGTAGAAGCAGAGAGTATATGG + Intergenic
954478447 3:50772255-50772277 TATTAGAGACAGAGAGTAGAAGG + Intronic
956443701 3:69305184-69305206 CTGGAGAAAATGAGACTAGAGGG + Intronic
956522027 3:70115686-70115708 CTGTAGACTCATAGAATAGAGGG - Intergenic
956777126 3:72574666-72574688 ATCTATAAACAGAGAGAAGAGGG + Intergenic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
957013498 3:75035590-75035612 CTGTTGAAACAGAAAATAAAAGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957386304 3:79501216-79501238 ATGTAGTAACAGAGAATGGATGG + Intronic
957411978 3:79853104-79853126 ATTTAGAAACAGAGAATGGAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957898663 3:86458099-86458121 GTTTAGAAAAAAAGAGTAGAAGG + Intergenic
958637003 3:96757709-96757731 TAATAGAAACAGAGAGTAGAAGG - Intergenic
959309423 3:104714537-104714559 ACATAGAAACAGAGAGTCGAAGG + Intergenic
959428737 3:106224958-106224980 CTACAGAGACAGAAAGTAGATGG - Intergenic
959654224 3:108782768-108782790 TCATAGAAACAGAAAGTAGAAGG - Intergenic
959781096 3:110234237-110234259 TAATAGAAACAGAGATTAGAAGG + Intergenic
959836768 3:110926984-110927006 ATGTAGAAACATACAATAGACGG + Intergenic
960121233 3:113950122-113950144 CGGTGGAAACACAGAGGAGAGGG - Intronic
960434673 3:117611137-117611159 CGGAAGAAACAGAGAGCAGAGGG + Intergenic
960505713 3:118490919-118490941 TTATGGAAATAGAGAGTAGAAGG + Intergenic
960540903 3:118861397-118861419 CTATGGACATAGAGAGTAGAGGG - Intergenic
960706376 3:120485970-120485992 TCATAGAAACAAAGAGTAGAAGG - Intergenic
963819307 3:149870245-149870267 GTGTAGAAACAGTGAGTTGGAGG + Intronic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
965987466 3:174773224-174773246 GTATAGAAATAGAGAGGAGAAGG + Intronic
965992419 3:174836288-174836310 TTATAGAGATAGAGAGTAGAAGG + Intronic
966244325 3:177789799-177789821 CTATAAAAGCAGAGAGGAGAGGG + Intergenic
966408368 3:179622836-179622858 CTATAAAAACAGAAAGTAAAAGG + Intronic
967329351 3:188275211-188275233 CTGTGGAAACAGAGAATCAAGGG - Intronic
967731875 3:192914730-192914752 CTGTACAAACAGAGAGCATCAGG + Intronic
968253023 3:197239948-197239970 GTGTAGAAACAGTGAGTTGTGGG - Intronic
969973460 4:11072337-11072359 CTGGAGAAACAAATAGTATAAGG + Intergenic
970469243 4:16359985-16360007 TTGCAGAAACACAGAGTAAAAGG + Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971248928 4:24955680-24955702 TTATAGAGACAGAAAGTAGAAGG + Intronic
972350693 4:38233745-38233767 TTGTAGAAACAGAGATCATATGG + Intergenic
972373789 4:38451078-38451100 CTTTAGAAACAGATAAAAGAAGG + Intergenic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973928695 4:55766991-55767013 CTGTAAAACCACAGAATAGAAGG + Intergenic
974111307 4:57528803-57528825 TAATAGAAACAGAGAGTAGAAGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975058609 4:69968275-69968297 ATATAGAAACAAAGAGTAGAAGG + Intergenic
975174996 4:71278127-71278149 CCATAGAAACGGAGAGTAAAAGG - Intronic
975275144 4:72488965-72488987 TTATAGAAATGGAGAGTAGAAGG - Intronic
975345351 4:73286881-73286903 CTGTAGAAACTGTGAGTTGGGGG - Intergenic
975380556 4:73695905-73695927 TTGGAGTAATAGAGAGTAGAAGG + Intergenic
975402039 4:73949757-73949779 CTGGAGAGACAGAAAGTATAAGG + Intergenic
976607926 4:86999948-86999970 CTGTAGTAACAGAAAGGAAAGGG + Intronic
977138427 4:93336162-93336184 CTGTAAAGAAAGAGAGGAGAAGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
977841219 4:101708369-101708391 CTATAGAGACAGAAAGTAGATGG + Intronic
978339070 4:107702544-107702566 CTGTAGAAGTAGAGAGTGAATGG - Intronic
978415130 4:108466810-108466832 TTGTCTAAAGAGAGAGTAGAGGG - Intergenic
978547217 4:109883905-109883927 TTGTGGACATAGAGAGTAGAAGG + Intergenic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
978876644 4:113647657-113647679 CGGAAGGAAGAGAGAGTAGAGGG + Intronic
978969097 4:114780727-114780749 TTGTAGAAACCGGGAGTTGAGGG + Intergenic
979027091 4:115591268-115591290 CTGAAGAAACAGAGTGTAGTGGG - Intergenic
979320343 4:119315958-119315980 GTGTAGAAAAAGAGACTAAAGGG + Intergenic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980320784 4:131271646-131271668 GTGTAGAAACAGTGAGTTGGTGG + Intergenic
980610646 4:135156899-135156921 TCATAGAAACAGAGAGTAGAAGG + Intergenic
980714627 4:136613920-136613942 TTGTAGAAGCAGAGATTAGCCGG - Intergenic
980974867 4:139600842-139600864 TTATAGAAACTGAAAGTAGAAGG - Intronic
980981813 4:139660802-139660824 GTGTAGAAAAAAAGAGTACAAGG - Intergenic
981476701 4:145194430-145194452 CCATAGAGACAGAAAGTAGAGGG + Intergenic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
982771089 4:159398214-159398236 CTGCAGAGACAGAGAGTATTAGG + Intergenic
983138978 4:164124738-164124760 CCATGGACACAGAGAGTAGAAGG + Intronic
983280609 4:165676648-165676670 GTATAGACACACAGAGTAGAAGG + Intergenic
983389345 4:167108617-167108639 CTATGGAAAGAGAGAGTAGAAGG + Intronic
983662813 4:170147423-170147445 TCCTAGAAACAGAGAGTAGAAGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984914173 4:184705911-184705933 TCATAGAAACAGAAAGTAGAAGG + Intronic
984960738 4:185094991-185095013 CTGTATAAACACAGAAGAGAAGG + Intergenic
985290495 4:188381716-188381738 CGCTTGAACCAGAGAGTAGAAGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986830797 5:11575476-11575498 ATGATGACACAGAGAGTAGAGGG - Intronic
986957568 5:13172572-13172594 TTATAGAAACAGAGAGTAGGAGG - Intergenic
987463129 5:18238375-18238397 ATGAAGAAACAGGGAGTAGGAGG - Intergenic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
988636979 5:32995319-32995341 CTTTGGGAACAGAAAGTAGATGG - Intergenic
988861245 5:35282192-35282214 CTATGGAAAGAGAGAGGAGAGGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
990036116 5:51322249-51322271 ATGTGGAAATAGACAGTAGAAGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990642235 5:57799739-57799761 TTTTAGAAACAGGGAGTACATGG + Intergenic
990880664 5:60533911-60533933 CACTAGAAACAGAGAGCAAATGG - Intergenic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
993253234 5:85554778-85554800 CAGGAGAGAGAGAGAGTAGAGGG + Intergenic
993364170 5:87016566-87016588 CTGTAAAAAGAGAAAGAAGAAGG + Intergenic
993472784 5:88326276-88326298 TCATGGAAACAGAGAGTAGAAGG - Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994667609 5:102725317-102725339 CTATAGAAACAGGAAGTACAAGG + Intergenic
995278107 5:110300957-110300979 TCGTGGACACAGAGAGTAGAAGG - Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
996856511 5:128014250-128014272 CTCTAGAACAAGAGAGTTGAAGG - Intergenic
997152442 5:131512822-131512844 CTGTAGCTTCACAGAGTAGAAGG - Intronic
997511110 5:134455179-134455201 TTATAGAGACAGAAAGTAGAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998472366 5:142393045-142393067 CTGTAACAACAGAGAAGAGAGGG - Intergenic
998659445 5:144219867-144219889 CAGGAGAAACTGAGAGCAGATGG + Intronic
998672489 5:144369310-144369332 CTCTAAAAACAAACAGTAGAGGG - Intronic
998866320 5:146506693-146506715 TCATAGAAATAGAGAGTAGATGG - Intronic
1000382801 5:160644342-160644364 CTGAAAAAACAGGGAGGAGAGGG - Intronic
1000487081 5:161860440-161860462 CCATGGAGACAGAGAGTAGAAGG + Intronic
1000910701 5:167018646-167018668 ATGAAGATACAGAGATTAGATGG - Intergenic
1001019464 5:168170718-168170740 GTGGAGGAACAGAGAGCAGACGG - Intronic
1002890717 6:1329297-1329319 TCATAGAAACAGAGACTAGATGG - Intergenic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1003126450 6:3360065-3360087 TCATAGAAACAGAAAGTAGAAGG + Intronic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1003590825 6:7435346-7435368 GTGTAGAAACAGTGAGTTGGGGG - Intergenic
1003597221 6:7484760-7484782 CCATAGAGACAGAAAGTAGAAGG - Intergenic
1003933211 6:10948455-10948477 TCATAGAAACAGAGAGTAGAAGG + Intronic
1004081236 6:12395482-12395504 CTTCAGCAACAGAGAGTAGAAGG + Intergenic
1007384551 6:41511906-41511928 TTGAAGACACAGAGAATAGAGGG + Intergenic
1007552126 6:42738242-42738264 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1007856356 6:44862327-44862349 CTGTAGTAAGAGCAAGTAGAGGG - Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009594402 6:65715811-65715833 CTGTAGCAACAGAAAATAGAGGG + Intergenic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010815863 6:80357346-80357368 CTGTTGAAACAGAATGGAGAGGG + Intergenic
1010837004 6:80600746-80600768 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1011253174 6:85394328-85394350 CAGTAGAAGCAGAGAGGAAATGG + Intergenic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013693608 6:112674368-112674390 ATGCAGAAAGAAAGAGTAGAAGG + Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014081870 6:117296614-117296636 CCATGGAGACAGAGAGTAGAAGG + Intronic
1014203686 6:118631755-118631777 CTATAGAAATGGAGAGTAAATGG + Intronic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014475122 6:121862613-121862635 CTGGAGATACAAAGAGGAGATGG - Intergenic
1014829461 6:126084884-126084906 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1014955198 6:127606637-127606659 CTGTAGAAACTGTGAGTCCAGGG + Intergenic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1016708121 6:147137687-147137709 CTGTTTGAACAGAGAGTAAATGG + Intergenic
1017223405 6:151992350-151992372 GCGTAGAAAGAGAAAGTAGATGG - Intronic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017341239 6:153324497-153324519 CTTTGGAATCAGAGAGCAGAGGG - Intergenic
1017753090 6:157507009-157507031 CAGTTGAAACTGAGAGTAGGGGG - Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019135105 6:169902924-169902946 TTGTAGAAACACAGACTAGAAGG + Intergenic
1019213608 6:170425225-170425247 CTGTTGAAACACAGAGCAGCTGG - Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019944991 7:4320575-4320597 CTGTAGAGACAGAAAATGGAAGG - Intergenic
1020650444 7:10868657-10868679 CTGTAGAAACAAAAAGGAAATGG + Intergenic
1020875820 7:13692211-13692233 CTGTAGAAATAGAGATGAAAAGG + Intergenic
1021542452 7:21775166-21775188 CTGTACTAATAGTGAGTAGATGG + Intronic
1022227182 7:28375323-28375345 CCATGGAGACAGAGAGTAGAAGG + Intronic
1022385708 7:29897020-29897042 TAATAGAGACAGAGAGTAGAAGG - Intronic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1022469571 7:30674067-30674089 CTGTGGAAATAGGGAGTTGAGGG - Intronic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1022753253 7:33254691-33254713 TCATAGAAACAGAGAGTAGCAGG - Intronic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024017441 7:45329796-45329818 CTGTGGAAACCCAGAGAAGAAGG - Intergenic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024667993 7:51564954-51564976 CTGAAGAAACGGAGAGTACAGGG - Intergenic
1025233353 7:57217651-57217673 CTGAAGAACCAGAGAGGAGGCGG + Intergenic
1025233906 7:57220790-57220812 CTGGAGAACCAGAGAGGAGCCGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026224397 7:68427854-68427876 GTGTTGAAACAGACAGTAGTGGG + Intergenic
1028008087 7:85603927-85603949 TTATGGAGACAGAGAGTAGAAGG - Intergenic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1029969877 7:104778518-104778540 CTGGAGAAACACAGAGTGAAGGG - Intronic
1029969977 7:104779411-104779433 CTGGAGAAACACAGAGTGAAGGG + Intronic
1030484327 7:110147868-110147890 GTGTAGAAACAGAAAGTGAATGG + Intergenic
1030550358 7:110951078-110951100 TCATAGAAACAGAGAGTAGAAGG + Intronic
1030562888 7:111113077-111113099 CTGAAGGAACTCAGAGTAGAAGG - Intronic
1030829773 7:114206995-114207017 CTATAGAAACAGAAAGAATAAGG - Intronic
1030950701 7:115787864-115787886 CTGTAGAAAGAGAAAGGAAAAGG + Intergenic
1031107369 7:117561506-117561528 TTATAGAGACAGAAAGTAGATGG - Intronic
1031387422 7:121168763-121168785 TCATAGACACAGAGAGTAGAAGG - Intronic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1032005597 7:128299880-128299902 CTATAGACACAGGGAGAAGATGG + Exonic
1032770065 7:135043410-135043432 TTGTAGAGACAGAGAATAGAAGG + Intronic
1032962317 7:137050749-137050771 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1033063704 7:138132046-138132068 CCATAGAAACAAAGAATAGAAGG - Intergenic
1033509211 7:142038084-142038106 TTATGGACACAGAGAGTAGAAGG - Intronic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033868420 7:145720204-145720226 CAGTAGAGACAGAGAGAATAGGG + Intergenic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1036127651 8:6078024-6078046 CTGCAGAAACAGAGAATAAGAGG + Intergenic
1036481394 8:9142699-9142721 TCATAGAAACAGAGAGTACAGGG - Intronic
1037072550 8:14669508-14669530 TCATAGAAATAGAGAGTAGAAGG - Intronic
1037182230 8:16021509-16021531 CTGCAGAAACAGAGATCAGTTGG - Intergenic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037244939 8:16822782-16822804 CAGGAGCAAGAGAGAGTAGAGGG + Intergenic
1038766117 8:30429281-30429303 CTGTATAAAGAGGGAATAGAAGG - Intronic
1039934888 8:42033649-42033671 CTGTGGAAACACAGAGGAGGGGG - Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040996347 8:53406626-53406648 CTGTAGAAAGATTGAGTGGAAGG + Intergenic
1041024878 8:53673847-53673869 AGCAAGAAACAGAGAGTAGAGGG + Intergenic
1041751475 8:61265720-61265742 CTGTAGTAACAGAGGGTAAGTGG - Intronic
1042392397 8:68251012-68251034 ATTCAGAAACAGAGAATAGAAGG + Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1043127496 8:76418064-76418086 CTGGAGAAAGAGAGAGTGAAGGG - Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1043557614 8:81450641-81450663 CCATGGAGACAGAGAGTAGAAGG - Intergenic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1045329918 8:101146751-101146773 GGGTAGAAACAGAGAGGACAAGG + Intergenic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1048256110 8:132906471-132906493 CTGTTAAAACTGAGAGCAGATGG + Intronic
1048791814 8:138111198-138111220 CTTTGGAAACAGTGAGTAGTAGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1050099497 9:2103325-2103347 TTGTAAAAACAGACAGCAGACGG + Intronic
1050172485 9:2836298-2836320 CTGGAGAAAAAGAGAATAAAAGG + Intronic
1050776541 9:9269811-9269833 TAATAGGAACAGAGAGTAGAAGG + Intronic
1051022432 9:12560004-12560026 CTGTAAAAAGAGAAAGTAGCAGG - Intergenic
1051227662 9:14918959-14918981 TCATAGAAACTGAGAGTAGAAGG + Intergenic
1051432704 9:16996544-16996566 CTATGGACATAGAGAGTAGAAGG + Intergenic
1051874685 9:21778996-21779018 CTGTAGAAGCTGAGAGCAGAAGG - Intergenic
1052629977 9:31025326-31025348 ATGAAGAAAGAGAAAGTAGAGGG + Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057104711 9:92401972-92401994 ATGTGCAAACACAGAGTAGAGGG - Intronic
1057270456 9:93647387-93647409 CTGCAGAAGCAGGGAGGAGATGG + Intronic
1057295506 9:93834435-93834457 CTGAACAAACCGAGAATAGAAGG - Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1057908543 9:99000941-99000963 CTGAAGAAAAGGTGAGTAGATGG + Exonic
1058356675 9:104092008-104092030 GGGTAGAAACAGAGAGTATAGGG - Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058858980 9:109095886-109095908 CTGGAGAAAAAGAGACTAGAGGG + Intronic
1058971053 9:110083215-110083237 CCGTAGAGACAGAAAGTAGAAGG - Intronic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059971272 9:119671202-119671224 CCATAGAAATAGAGAATAGAAGG + Intergenic
1060097078 9:120800900-120800922 TCATAGAAACAGAGAGTAAATGG - Intergenic
1060481038 9:124017031-124017053 TTGTGCAAAAAGAGAGTAGAAGG + Intronic
1185545784 X:942992-943014 GTGTACAGAGAGAGAGTAGAGGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186976841 X:14916923-14916945 ATGTAGAAAAGGAGAATAGAAGG + Intronic
1187577719 X:20576089-20576111 CTGTAGACCCAGAGAGTTCAGGG - Intergenic
1188478984 X:30618182-30618204 GTGTAGAAACAGGGAGTTGGGGG - Intergenic
1188603855 X:32003782-32003804 CTTTAAAAACACAGAGTAGTTGG + Intronic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189845594 X:45133495-45133517 TCGTGGAGACAGAGAGTAGAAGG - Intergenic
1189887391 X:45562219-45562241 CTGAAGTAAGAGAGAGTAAAGGG + Intergenic
1190254357 X:48751487-48751509 TCATAGAAACAGAAAGTAGAAGG + Intergenic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1191051900 X:56202612-56202634 TCATAGACACAGAGAGTAGAAGG - Intergenic
1191201670 X:57789610-57789632 TTGTGGACACAGAGAATAGAAGG + Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1191999073 X:67128240-67128262 CAGTAGAAAGAGAGAGTGAAGGG - Intergenic
1192312240 X:70026797-70026819 AAGCAGAGACAGAGAGTAGAGGG - Intronic
1192484819 X:71515984-71516006 CCATAGAAACGGAAAGTAGAAGG + Intronic
1192488341 X:71550859-71550881 TCATAGAAACAGAGAGTAGAAGG + Intronic
1192635930 X:72817572-72817594 CTGCAGAAACTGAGTATAGAAGG - Intronic
1192645784 X:72903231-72903253 CTGCAGAAACTGAGTATAGAAGG + Intronic
1192689309 X:73344971-73344993 TTATAGAAACAGAGAGGATAAGG + Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193292993 X:79799423-79799445 TTATAGACACAGAGAGTAGAAGG - Intergenic
1193998855 X:88401227-88401249 CAGAAGAAACAGAGAGCAGAGGG - Intergenic
1194374156 X:93111717-93111739 TTATAGACAGAGAGAGTAGAAGG - Intergenic
1194529051 X:95021531-95021553 TCATAGAAACGGAGAGTAGAAGG + Intergenic
1194715173 X:97279616-97279638 TTTTAGAAACAGAGACTGGATGG - Intronic
1194720108 X:97330360-97330382 TCATAGAAACAGAGAGTAGGTGG - Intronic
1194925841 X:99822082-99822104 CCATAGACATAGAGAGTAGAAGG + Intergenic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196407699 X:115382397-115382419 CCATAGAGATAGAGAGTAGAAGG + Intergenic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1197497013 X:127196620-127196642 CTGTAGAAATAGTGAGTTGGGGG - Intergenic
1197873529 X:131082305-131082327 GTCGAGAGACAGAGAGTAGAGGG + Intronic
1197948251 X:131863771-131863793 CTGCAGAAACATACAGTAGTAGG - Intergenic
1197998260 X:132404032-132404054 GCATAGAAACAGAGAGTAGAAGG - Intronic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1199222371 X:145332355-145332377 TTATAGAAGTAGAGAGTAGAAGG - Intergenic
1199435149 X:147804646-147804668 AGGTAGAAAGAGATAGTAGAAGG + Intergenic
1199531009 X:148847599-148847621 CTCTAGATCCAGAGAGTTGATGG + Intronic
1199649706 X:149939497-149939519 CGGGAGAAACAGGGAGGAGATGG + Intergenic
1199733540 X:150661737-150661759 CTATAGTAACAGAGAGTAGAAGG + Intronic
1199970802 X:152859413-152859435 CCATAGAGACAGAAAGTAGAAGG - Intronic
1200088591 X:153623957-153623979 CAGGAGAGACAGAGAGGAGAAGG + Intergenic
1200143773 X:153915191-153915213 CTGTAGAGACGGACAGTGGAAGG + Intronic
1201050975 Y:9934928-9934950 CTGAAGAAACAGAGATGAGAAGG + Intergenic
1201299893 Y:12496444-12496466 CTGTAAAGACAGGGAGAAGACGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic