ID: 1013467609

View in Genome Browser
Species Human (GRCh38)
Location 6:110430953-110430975
Sequence AACAGCTCAGCAGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013467606_1013467609 4 Left 1013467606 6:110430926-110430948 CCTTTTGTGGCAGGCAGAGTTGT 0: 1
1: 0
2: 1
3: 29
4: 229
Right 1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 237
1013467602_1013467609 26 Left 1013467602 6:110430904-110430926 CCAGGCAAGGGTGAGGACATGCC 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 237
1013467605_1013467609 5 Left 1013467605 6:110430925-110430947 CCCTTTTGTGGCAGGCAGAGTTG 0: 1
1: 0
2: 1
3: 24
4: 195
Right 1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013467609 Original CRISPR AACAGCTCAGCAGTGGTGGA AGG Intronic
900241124 1:1618089-1618111 CACAGCCCAGCACTGGTGGAGGG - Intronic
900482332 1:2905282-2905304 CACAGATCAGCAGTGTTGGAGGG + Intergenic
901104770 1:6746526-6746548 AAAATCTCACCATTGGTGGAGGG + Intergenic
903442662 1:23400159-23400181 AACAGCAGAGCAGTGGTAAATGG - Intronic
903716278 1:25369583-25369605 AACAGCTCAGCAGCTGCTGAGGG - Intronic
904652067 1:32013483-32013505 AACGGCTGAGCAGTGGAGGGAGG - Intergenic
906196960 1:43935613-43935635 AACAGCTCAACAATGGCTGATGG + Exonic
907657068 1:56354816-56354838 ATCAGCTCAGAAGCGGTAGACGG - Intergenic
908572178 1:65421022-65421044 AAAAACTCAGGAGAGGTGGAGGG - Intronic
909560861 1:77007947-77007969 TCCAGCTGAGCAGTGATGGATGG + Intronic
914898750 1:151699749-151699771 AAAAGCTCAGCATTTGTGGTGGG + Intergenic
916232335 1:162552878-162552900 AACAGCCCAGCAGAGATGGATGG + Intergenic
916314952 1:163438720-163438742 AGCAGCTCAGTGGTGGAGGAAGG - Intergenic
916456386 1:164975014-164975036 AACAGGCCAGCAGAGTTGGAAGG + Intergenic
917894702 1:179476271-179476293 AACAGCACACAAGAGGTGGATGG - Intronic
918423227 1:184385402-184385424 AACAAGTCACCAGTGGTGAAAGG + Intergenic
919786078 1:201259585-201259607 GACAGCTCAGCAGGGGAAGATGG + Intergenic
922414260 1:225406082-225406104 AACAGCTCAGCAAGGGTGTGTGG - Intronic
922660666 1:227427723-227427745 AACAGCTCAGAGTTGGTGGGAGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922964181 1:229674283-229674305 AACAGCTGAGCAGGGGGAGAGGG - Intergenic
924582247 1:245332599-245332621 AACATGTCAGCAGTGGGGGTGGG - Intronic
924706035 1:246502968-246502990 TATAGCACAGCAGTGGTAGAAGG - Intronic
1063107143 10:3002381-3002403 AACAACTCTGCAGATGTGGAGGG - Intergenic
1063894270 10:10662712-10662734 AACAAACCAGCAATGGTGGAGGG + Intergenic
1063968585 10:11365556-11365578 AAGAGCTGAGTTGTGGTGGAGGG + Intergenic
1063968596 10:11365628-11365650 AAGAGCTGAGTTGTGGTGGAGGG + Intergenic
1063968609 10:11365736-11365758 AAGAGCTGAGTTGTGGTGGAGGG + Intergenic
1065697359 10:28392161-28392183 CACAGCTCAGGAGTGATGGGTGG - Intergenic
1067279130 10:44858050-44858072 AAGAGCCCAGCAGTGGTAGATGG - Intergenic
1070744551 10:78925385-78925407 ACAAGCTCACCTGTGGTGGATGG - Intergenic
1070776820 10:79114664-79114686 AAAAGCTTAGCATTTGTGGAGGG - Intronic
1073799186 10:107022761-107022783 AACAACACAGCAGTGGTTCAGGG + Intronic
1074071601 10:110075538-110075560 AACAGCTGGGCAGTTGTGGATGG + Intronic
1074256566 10:111808322-111808344 AGCAGATCAGCAGTGGTGCCAGG - Intergenic
1074440677 10:113475035-113475057 GAAATTTCAGCAGTGGTGGAGGG + Intergenic
1074897241 10:117787702-117787724 ATTAGCTCAGGAGTGGTGGTGGG + Intergenic
1075761156 10:124857949-124857971 AACAGCTCAGCATTCTTTGAAGG - Intergenic
1075856936 10:125637849-125637871 AGCAGCTCAGGAGTGGGGGCAGG - Intronic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076833413 10:133008171-133008193 CACATCCCAGGAGTGGTGGATGG + Intergenic
1077245426 11:1534704-1534726 AACCGCGGATCAGTGGTGGAAGG + Intergenic
1077552647 11:3207990-3208012 AGCAGCTCAGCAGCGGTGCCTGG - Intergenic
1077842354 11:5989295-5989317 AACAGCTGTGCATTTGTGGAAGG + Intergenic
1077915657 11:6610071-6610093 ACCACCTCAGAAGTAGTGGAAGG + Intronic
1078187646 11:9065923-9065945 AACACCACATCAGTGGTGGATGG - Exonic
1078817067 11:14836145-14836167 AAAAGCACAGGACTGGTGGAAGG - Intronic
1080397242 11:31901586-31901608 AACATCTCAGCACTGGTGACAGG + Intronic
1080634807 11:34114431-34114453 AGCAGCTCAGTAATGGTGGTCGG + Intronic
1081757285 11:45553876-45553898 AACAGCTCACCTCTGGGGGAGGG + Intergenic
1082988506 11:59187601-59187623 AACAGCTCTGCTGTGGGGGCAGG - Intronic
1083451933 11:62752132-62752154 GACAGAGCAGCAGTGGTGGAGGG - Exonic
1085621391 11:78040576-78040598 CACAGAACAGGAGTGGTGGATGG - Intronic
1085839130 11:79990346-79990368 AACAGCTCAGCAGTGCTAATAGG + Intergenic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1089560762 11:119341978-119342000 GCCAGCTCTGCAGGGGTGGAGGG + Exonic
1095304684 12:40625818-40625840 AACAGATTGGCAGTGGGGGAAGG - Intergenic
1097422543 12:59398309-59398331 CACAGTTGTGCAGTGGTGGATGG + Intergenic
1098040987 12:66353916-66353938 AACATCTCAGCAGTTGTAAAGGG - Intronic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1098424364 12:70343129-70343151 AAGAGCTCTACAGTGGTGGTGGG - Intronic
1100980149 12:100157131-100157153 AACATCTCTGTAGGGGTGGAGGG - Intergenic
1102081654 12:110103190-110103212 AAAATGTCAGCAGTGTTGGAAGG + Intergenic
1102536177 12:113583186-113583208 CACAGCTCTGCAGTGGTGGAGGG + Intergenic
1102784806 12:115595771-115595793 AACAGGTCTGCAGTAGGGGAGGG - Intergenic
1105836673 13:24218047-24218069 AATAGCTCAGCCCTGCTGGAGGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1111180749 13:84661494-84661516 AAAAGCTCAGCAGTGTTGACTGG + Intergenic
1111761411 13:92470632-92470654 TACTGCTCAGCAGTGGTTGAGGG - Intronic
1112383802 13:98919090-98919112 AACAGCCCAGCAGTGCTGAAGGG - Intronic
1112551443 13:100424483-100424505 AACAGCGCAGCATGGCTGGAGGG - Intronic
1114345730 14:21792711-21792733 TATAGCTCAGGAATGGTGGATGG + Intergenic
1116395599 14:44445406-44445428 AAAAGCTCTGAAGTGGGGGATGG - Intergenic
1117965534 14:61203425-61203447 AACATCTCAGGCATGGTGGAGGG + Intronic
1118081482 14:62366761-62366783 AGCATCTCAGCAGAGGTTGATGG + Intergenic
1118321931 14:64758380-64758402 AACAGGTAAGCAGTGCAGGAGGG + Intronic
1119480160 14:74953903-74953925 AACGGCTCGTCAGAGGTGGAAGG - Exonic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1121243849 14:92448956-92448978 CACAGCCCAGGAGTGGTGGGTGG - Intronic
1121785695 14:96659175-96659197 AACAGATCAGGAGTGGGAGATGG + Intergenic
1121831001 14:97052486-97052508 AACAGCTCAGCACTGGGGGTGGG + Intergenic
1127410958 15:58706640-58706662 AACAGGTCTGCAGAGGAGGAAGG + Intronic
1128103695 15:65027803-65027825 AACTGCTAAACAGAGGTGGAAGG + Intronic
1129120588 15:73394080-73394102 ACCATCTCAGCATTCGTGGAAGG - Intergenic
1131150682 15:90045668-90045690 GACAGCTGAGCTCTGGTGGAGGG + Intronic
1132473877 16:122706-122728 AATAGCTCGGCAGTGATAGAAGG - Intronic
1133129193 16:3665756-3665778 CACAGCACAGCACTGGTGGGAGG + Intronic
1134391362 16:13823256-13823278 AACATAACAGCAGTGGTAGAAGG + Intergenic
1134809864 16:17158251-17158273 AACACATCAGCAGGGGTGGGAGG - Intronic
1136292503 16:29284369-29284391 CACAGCTCAGCAGAGCTGAACGG + Intergenic
1136922436 16:34344052-34344074 CCCAGCTCAGGACTGGTGGAAGG - Intergenic
1136982137 16:35067754-35067776 CCCAGCTCAGGACTGGTGGAAGG + Intergenic
1138489311 16:57366907-57366929 AACAGCTCTGGAGAGGAGGATGG - Intergenic
1139045045 16:63047849-63047871 GTCAGCTCAGCTGTGGTGGACGG + Intergenic
1139521375 16:67484389-67484411 AACAGCTCTGCAGTGGGGTGAGG - Intergenic
1140172487 16:72620830-72620852 AACAGCTCAGCACACATGGATGG + Intergenic
1142098395 16:88258386-88258408 CACAGCTCAGCAGAGCTGAATGG + Intergenic
1143477344 17:7210499-7210521 GACAGCTCAGCCTTGGAGGAGGG - Intronic
1144306194 17:13971448-13971470 AGCAGGTCATCAGTGGTGAAGGG + Intergenic
1146050424 17:29547418-29547440 AGTGGCTCAGAAGTGGTGGAAGG - Exonic
1147518375 17:41143684-41143706 AACAGATGTGCAGTGGAGGAAGG - Intergenic
1148836319 17:50467689-50467711 AACAGCAGAGGAGGGGTGGAAGG + Intronic
1149169536 17:53792709-53792731 AACCACCCAGCACTGGTGGAGGG - Intergenic
1150508085 17:65719767-65719789 AAAAGATCAGCACTGGTAGAGGG + Intronic
1150898263 17:69238985-69239007 AACAGCTAGGCTGTGGGGGATGG - Intronic
1151820755 17:76495564-76495586 AACAGCTCAGCTGAGGTACAAGG + Intronic
1152908470 17:82983622-82983644 AACAGCTCAGCAATGGTGACAGG + Intronic
1156171614 18:34493540-34493562 GACAGCTCCGGAGTGGGGGAGGG + Intronic
1157454599 18:47814721-47814743 ACTAGCTCAGCATTGGTGGAAGG + Exonic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1158709307 18:59823365-59823387 AAGAGCTCAGCAATGATGTATGG + Intergenic
1159355926 18:67337410-67337432 ATCTGCTCAGAAGTGGTGGAGGG + Intergenic
1160017506 18:75155722-75155744 GTGAGCTCAGCACTGGTGGAAGG + Intergenic
1160110633 18:76026586-76026608 AACAGCTCAGCAAAGGAGGCAGG + Intergenic
1160630022 18:80240483-80240505 AAGAGCTCAGCATTGGAGGTGGG - Intronic
1161363707 19:3867035-3867057 AATATCACAGCACTGGTGGAAGG + Intronic
1162247111 19:9410590-9410612 CACAGCTCAACATTGGTGGAAGG + Intergenic
1164270778 19:23669887-23669909 AGTAGGTCATCAGTGGTGGAGGG + Intronic
1164464531 19:28476199-28476221 ACCAGCTCATCAAGGGTGGAAGG - Intergenic
1165380442 19:35475842-35475864 ATCAGATCACCAGTGCTGGAGGG + Intergenic
1166385146 19:42376506-42376528 CGCAGCCCAGCAGTGGTGGCGGG - Exonic
926095114 2:10076365-10076387 TACAGCGCAGCAGTAGTGGATGG - Intronic
926432753 2:12806067-12806089 AACATCTGAGCAGTAGTGCATGG + Intergenic
927642685 2:24855433-24855455 AAGAGCCGAGCAGGGGTGGAAGG + Intronic
927961068 2:27241042-27241064 ATCAGCTCTGCAGTGAGGGATGG - Exonic
929533474 2:42766425-42766447 AGGAGCTCAGCAGTGTTGGTGGG - Intergenic
930410030 2:51013716-51013738 AACAGGTCAGCAGAAGTGGTGGG - Intronic
932609517 2:73188277-73188299 AAAAGCTCACCAGGGGAGGAGGG + Intergenic
932966140 2:76477069-76477091 AACAATTCACCAGTGATGGAAGG - Intergenic
933295534 2:80486779-80486801 AACTTCTCAGCATTGGTGTAAGG - Intronic
937336836 2:121067403-121067425 AGCAGCTGAGCAGTGGGGCAAGG + Intergenic
937615696 2:123919637-123919659 AAAAGCTAAGCAGACGTGGAAGG + Intergenic
940061382 2:149573437-149573459 AACAGCTAAGCAGAGGAGGTTGG - Intronic
940583665 2:155615067-155615089 AACACCTCAGTAGTAATGGATGG + Intergenic
945043508 2:205762416-205762438 AACAGCAAAGCAGTGGTCCAGGG + Intronic
945394995 2:209306584-209306606 AACAAACCAGCAGTGGTGGATGG - Intergenic
946071801 2:217040451-217040473 ACCAGCCCCGCAGTGCTGGATGG + Intergenic
947297697 2:228650871-228650893 AAATGCTCAGCAGTGATAGATGG + Intergenic
948055108 2:235005241-235005263 AACAGCACAGCAGGGCTGGGAGG - Intronic
948059022 2:235030189-235030211 AAGGGCTCACCAGAGGTGGATGG + Intronic
948654538 2:239468661-239468683 AGCAGTGCAGCAGTGGTGGCTGG + Intergenic
948903891 2:240968834-240968856 AACGGCCAGGCAGTGGTGGATGG + Intronic
1169421592 20:5465103-5465125 AGCCGCCCAGCACTGGTGGAGGG - Intergenic
1170528657 20:17267115-17267137 AAAAGGGCAGCAGGGGTGGATGG - Intronic
1170802677 20:19603305-19603327 GACAGCTCAGCAGGGGGTGATGG + Intronic
1172043510 20:32062888-32062910 AACAGCTCAGCAATGGGGGTGGG - Intronic
1173155663 20:40606489-40606511 ACCAGCTTAGCAGTTGTGTAAGG + Intergenic
1174193559 20:48757243-48757265 AACAGCTCAGTGCAGGTGGAGGG - Intronic
1175461950 20:59158410-59158432 AACAGGTCAGCAGAGGTGAGGGG + Intergenic
1175641135 20:60631402-60631424 AGCAGCTAAGGAGTGATGGATGG - Intergenic
1183690810 22:39387384-39387406 AAGAGCTTGGAAGTGGTGGAAGG + Intergenic
1184887004 22:47352503-47352525 AACTGCTCTGCAGTGGGGGGAGG - Intergenic
949708226 3:6843070-6843092 AACACCTAAGCTGTTGTGGATGG + Intronic
949806111 3:7957721-7957743 GACAGCTCAGCAGAGGAAGAGGG - Intergenic
950331006 3:12156151-12156173 AAAAGCACAGCAGTGGGGGAGGG - Intronic
951587677 3:24232136-24232158 AACAGTTCAGCACTAGGGGAAGG + Intronic
951867616 3:27325343-27325365 ATCAGCTCAGCTGTGGAGGTGGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
955395214 3:58552405-58552427 AATACCTCAGCTGTGGGGGAAGG + Intergenic
956044045 3:65176266-65176288 AGAAACTCAGCAGTGGTGTATGG - Intergenic
956262898 3:67364335-67364357 TACCGCTGAGCAGGGGTGGAAGG - Intronic
956624068 3:71249537-71249559 AACAGCTAAGCAGTGGAGTCCGG + Intronic
959015453 3:101129161-101129183 AACAGCTCAGAAGTGGAGGCTGG - Intergenic
959019451 3:101172261-101172283 AACAGATCAGCAGTGGGGAGGGG + Intergenic
959670384 3:108970704-108970726 AGCTGCTCAGCAGAAGTGGAGGG - Intronic
960639400 3:119811822-119811844 CACAGCTAATCAGTGGTGGAGGG + Intronic
960673677 3:120175169-120175191 AGCAGCTCAGCACTGGCGTAAGG + Intronic
962368314 3:134800532-134800554 AAAAGCTCAGCAGGTTTGGATGG + Intronic
962784619 3:138755633-138755655 TACAGATCAGCAGTGGTCCATGG + Intronic
962865993 3:139448396-139448418 CACAGCTCAGCAGTGGCAGAGGG - Intergenic
962910909 3:139848657-139848679 AACAGTCCAACAGTGGTGGCAGG + Intergenic
964626369 3:158763938-158763960 GACAGTGCAGCAGTGGGGGAAGG - Intronic
964811190 3:160666434-160666456 AAAAGCACTGCAGTGGGGGAGGG - Intergenic
968730912 4:2268811-2268833 ACCAGGTCAGCAGTGGCAGAGGG - Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
978531912 4:109723350-109723372 AACTGCTCAGCAGTCGAGAATGG - Intronic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982085045 4:151826180-151826202 AAGAGCTCAGCAGAGGTCTAAGG - Intergenic
985557912 5:566856-566878 GGCATCTCAGCAGTGGTGAAAGG + Intergenic
985779703 5:1863932-1863954 AAGAGCTCAGGAGTGGGGGAAGG - Intergenic
988026825 5:25705491-25705513 AACAGCACAGCAGTGATTGGTGG - Intergenic
988588887 5:32531713-32531735 AACAGCTCAGAGATGGTGGAGGG + Intronic
989527716 5:42472634-42472656 TCCAGCTGAGGAGTGGTGGATGG + Intronic
990358952 5:54998301-54998323 AAGAGCTGAGCTGTGGAGGAGGG - Intronic
990621284 5:57562096-57562118 ATCAGCTAAGCAGGGGTGGGTGG - Intergenic
992565439 5:77991221-77991243 AATAGGTGGGCAGTGGTGGAAGG + Intergenic
995297302 5:110536928-110536950 AATGGGTCATCAGTGGTGGAGGG + Intronic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997201243 5:132011382-132011404 GACAGCTCAGCAGCAGGGGATGG + Intronic
998251144 5:140553710-140553732 AACAGGTCAACAGTGGTGGCAGG + Intronic
998600559 5:143580961-143580983 TAAAGATCACCAGTGGTGGAGGG + Intergenic
1000039428 5:157474154-157474176 GGCAGCTCATCAGTGGAGGAGGG - Exonic
1000274364 5:159720144-159720166 AACACCTGAGAAGTGATGGAGGG - Intergenic
1000359715 5:160435776-160435798 AAAAGGTCAGCAGGGCTGGAGGG + Intergenic
1000644533 5:163744915-163744937 AATAGTTCAGCAATGGTGGAGGG - Intergenic
1001862287 5:175067776-175067798 AGCAGCTCAGCGGGGGTGCATGG - Intergenic
1001896042 5:175382228-175382250 CACAGCTCAGTGGAGGTGGAGGG - Intergenic
1003432042 6:6047825-6047847 AGCAGCTCAGCAGAGATGGTGGG + Intergenic
1005915652 6:30348394-30348416 AGGAGGTGAGCAGTGGTGGAAGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1012037643 6:94163092-94163114 AGGAGGTGAGCAGTGGTGGAGGG - Intergenic
1012334596 6:98039643-98039665 AAAAGGTCAGCAGTGGCAGAAGG - Intergenic
1013150371 6:107440067-107440089 ACCAGCTCAGCCTTGGTGGGAGG - Intronic
1013278562 6:108611038-108611060 AGTAGCTCAGCAGTTGTGGGTGG - Intronic
1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG + Intronic
1013686852 6:112595110-112595132 AACAGTTCAGCAGGGGTTGGAGG + Intergenic
1015762564 6:136680871-136680893 AAGAGCTCTGCAGGGGAGGAAGG + Intronic
1016986624 6:149900379-149900401 AACAGCTCCCCAGGGGTGAAGGG + Intergenic
1019049972 6:169175166-169175188 AGCAGCAGAGCAGGGGTGGAAGG - Intergenic
1019810263 7:3159817-3159839 AACAGCCCAGCAGTTGTTTAAGG - Intronic
1020872402 7:13648336-13648358 GACAGCTCAACTGTGGTGGGAGG + Intergenic
1021857565 7:24872047-24872069 GACAGCTGGGAAGTGGTGGAAGG - Exonic
1022970585 7:35513363-35513385 AACAGCTCTGCAGCTGGGGAAGG - Intergenic
1024115710 7:46191184-46191206 TACAACTCAGCAATGGTGAAAGG - Intergenic
1026356844 7:69565267-69565289 AAGGGCTGAGCAGTGTTGGAGGG + Intergenic
1026769802 7:73188395-73188417 AGGAGCTCCGCAGTGATGGATGG + Intergenic
1026838277 7:73652658-73652680 AACAGCTTAGCAGGTGTGGGCGG - Intergenic
1027010670 7:74741777-74741799 AGGAGCTCCGCAGTGATGGATGG + Intronic
1027077372 7:75204263-75204285 AGGAGCTCCGCAGTGATGGATGG - Intergenic
1028193066 7:87875086-87875108 AACAGATCTTGAGTGGTGGAAGG - Intronic
1028529697 7:91824951-91824973 AACAGCACAGAAGTTGTGGCAGG - Intronic
1029512742 7:101006626-101006648 AACAGCATGGCAGTGTTGGAAGG + Intronic
1030086797 7:105822734-105822756 CATAGCTAAGCAATGGTGGATGG + Intronic
1031010801 7:116524660-116524682 ATCATCTCAGCAGGGGTGGAGGG - Intergenic
1031084537 7:117289501-117289523 AAAAGCTAAGCAGTGCTGGGTGG + Intronic
1031165141 7:118218827-118218849 AACAGCTCATTAGTGATAGAAGG + Intronic
1031439234 7:121772786-121772808 AAGAGCTCAGCTGTGGTAGCAGG - Intergenic
1031484259 7:122309543-122309565 AAAATCTCAGCATTAGTGGAGGG - Intronic
1034974561 7:155440269-155440291 AAGTACTCAGCAGAGGTGGAAGG - Intergenic
1036777582 8:11624232-11624254 AACACCGCAGCAGTGGTATACGG - Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037633138 8:20676559-20676581 AACACCTCACCATTGGTGGAGGG + Intergenic
1038253954 8:25933263-25933285 AACAGCTCAGCGCTGATAGATGG - Intronic
1039310541 8:36313732-36313754 AACACCTCAGTAATGGCGGATGG + Intergenic
1040276480 8:46016545-46016567 AACAGCACATCAGTGTTGAAAGG - Intergenic
1041336722 8:56793658-56793680 AACAGCTCAGCAGTGCTTTCTGG - Intergenic
1043423334 8:80122981-80123003 AGCAGGTCAGCAGTGGGGCATGG + Intronic
1043931700 8:86098925-86098947 AACAGCTCTGTAGTCCTGGACGG - Exonic
1044678277 8:94751435-94751457 AACAGCATAGTAGTGGTGGTTGG - Intronic
1046222097 8:111229460-111229482 AACAACTCAGCAGTGATACATGG + Intergenic
1047374215 8:124280904-124280926 AAAAGCTCCGCAGTGGCTGAAGG + Intergenic
1048504203 8:135006151-135006173 ACCAGCACATCAGTGGGGGAAGG - Intergenic
1050613648 9:7379315-7379337 AACAGTTTATCAGAGGTGGATGG + Intergenic
1053020913 9:34693332-34693354 AGCAACTGATCAGTGGTGGAAGG + Intergenic
1053053828 9:34981910-34981932 GACAGCTCAGCCCTGGTGTAGGG + Exonic
1053414940 9:37941548-37941570 CACTGCTCAGCAGTGGTTGCAGG - Intronic
1053923081 9:43019300-43019322 AACACCTCGGCAGTGCAGGAAGG - Intergenic
1054801561 9:69354718-69354740 AACACTTCACCAGTGGTGGTAGG + Intronic
1056231681 9:84552278-84552300 AAAACCTCATCAGTGGTGGGAGG - Intergenic
1056253379 9:84773390-84773412 AAGAACACAGCAGTGATGGAGGG + Intronic
1056803861 9:89713029-89713051 AACAGCCCAGCAGTGGGGCAGGG + Intergenic
1057810382 9:98252779-98252801 AACAGCTCACCGGGCGTGGATGG + Intronic
1059437545 9:114285657-114285679 GACAGCTCAGCCATGGTAGACGG + Intronic
1059763596 9:117362500-117362522 CACAGGTCAGCAGGGATGGAGGG - Intronic
1060422990 9:123482864-123482886 AACAGGACAGCAGAGGGGGAGGG + Intronic
1061120658 9:128640402-128640424 AGCAGCTGAGCAGTGGAGGCAGG - Intronic
1061434220 9:130550837-130550859 AACTGCCCAGAAGTGGAGGAGGG + Intergenic
1061576560 9:131510896-131510918 AACCTCGCAGCAGTGGTAGAAGG + Intronic
1062186812 9:135222586-135222608 CTCAGCTGAGCTGTGGTGGATGG - Intergenic
1186753915 X:12649960-12649982 AACAGCTCTGCAGGGGCAGATGG - Intronic
1191007882 X:55729654-55729676 AAGAGCTCAGCACTGGTGTCAGG - Intronic
1196684312 X:118496876-118496898 CACAGCTCAGGACTGGGGGATGG + Intronic
1197281138 X:124537454-124537476 CACAGCTCATAAGTGGTGGAGGG + Intronic
1198038752 X:132827767-132827789 TACGGCTCAGCAGTGGTTGTAGG - Intronic
1198077103 X:133204372-133204394 AAGAGCTCAGAAGGGATGGAAGG + Intergenic
1198969633 X:142266854-142266876 AAGAGGTCAGCAGAGGTGAAAGG - Intergenic
1199785009 X:151097632-151097654 AACTGCAGAGCAGTGGAGGAAGG + Intergenic
1201680935 Y:16643117-16643139 AAGAGGTCAGCAGAGGTGAAAGG + Intergenic
1202050991 Y:20780672-20780694 AGCAGCTCAGCAGTGGGGAGTGG + Intronic