ID: 1013468216

View in Genome Browser
Species Human (GRCh38)
Location 6:110436252-110436274
Sequence TGGTGCCACCAGCACTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013468216_1013468225 25 Left 1013468216 6:110436252-110436274 CCCTGATAGTGCTGGTGGCACCA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1013468225 6:110436300-110436322 TGATCCAGCAGAATGAATCAAGG 0: 1
1: 0
2: 0
3: 9
4: 242
1013468216_1013468219 -1 Left 1013468216 6:110436252-110436274 CCCTGATAGTGCTGGTGGCACCA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1013468219 6:110436274-110436296 AAGAATTTCCCCACTCCTTCTGG No data
1013468216_1013468220 0 Left 1013468216 6:110436252-110436274 CCCTGATAGTGCTGGTGGCACCA 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1013468220 6:110436275-110436297 AGAATTTCCCCACTCCTTCTGGG 0: 1
1: 0
2: 2
3: 19
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013468216 Original CRISPR TGGTGCCACCAGCACTATCA GGG (reversed) Intronic
902227236 1:15004096-15004118 TGGAGCCTCGTGCACTATCAGGG + Intronic
902270347 1:15299875-15299897 TGTTGCCACAAGCACTCACAGGG + Intronic
905505365 1:38475341-38475363 TGGTGGCATTACCACTATCAGGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906140280 1:43530382-43530404 TGGTGCTAGCGTCACTATCAAGG + Intronic
907393943 1:54176839-54176861 TGGTGGCAGCAGAACCATCAAGG + Intronic
913042527 1:115041250-115041272 AGGTGACACCAGCACTCTCGTGG - Intergenic
915749185 1:158188826-158188848 TATTTCCAGCAGCACTATCAGGG + Intergenic
916498229 1:165364681-165364703 TGGTACCACCAGAAGGATCAAGG - Intergenic
921948404 1:220904905-220904927 TGGGCTCACCAGCACTACCACGG - Intergenic
1067810938 10:49426604-49426626 TCATGCCACCTGCACTACCATGG + Intergenic
1069747925 10:70727552-70727574 TGATGCCACCAGCGCGGTCAGGG - Intronic
1069747930 10:70727578-70727600 TGATGCCACCAGCGCAGTCAGGG - Intronic
1069747938 10:70727630-70727652 TGATGCCACCAGCATGGTCAGGG - Intronic
1069747947 10:70727682-70727704 TGATGCCACCAGCATGGTCAGGG - Intronic
1069952456 10:72028674-72028696 TGGTGCCTCCATAATTATCAAGG - Intergenic
1070359660 10:75675069-75675091 TGATCCCACCAGCATTTTCAAGG - Intronic
1070730528 10:78824729-78824751 GGGTGACACCAGCAGTAACATGG - Intergenic
1072042000 10:91615733-91615755 TGGTGCCACCACCACCATTTGGG - Intergenic
1078443411 11:11386057-11386079 AGGTGCCAGCAGGACTATGAGGG - Intronic
1081848724 11:46260181-46260203 TGGAGCCATCAGCATTACCATGG - Intergenic
1083315152 11:61810431-61810453 AGGTGCCATCAGCACCTTCAAGG + Intronic
1086875582 11:92091679-92091701 TTGTGCCATCAGCAATAACATGG - Intergenic
1088626043 11:111731442-111731464 TGGTGCCTCCAGCACCCTGAGGG - Intronic
1088775997 11:113083755-113083777 TGGGGCCACCAGCACTACATTGG - Intronic
1090354740 11:126132642-126132664 TGGTGCCACCAGGCCTGTGAGGG + Intergenic
1098224734 12:68309886-68309908 TTCTGCGACCAGCACTACCAGGG - Intronic
1098730934 12:74036367-74036389 TGGTGCCACCAGCAAGACCTTGG + Intergenic
1101111616 12:101492070-101492092 TGATACCATCACCACTATCAAGG + Intergenic
1101191268 12:102335935-102335957 TGGTGTCATCAGCACAATAATGG - Intergenic
1101338998 12:103824689-103824711 TGATGCCACCAACACAATAAAGG + Intronic
1102289077 12:111684582-111684604 TAATGGCACCAGCAGTATCATGG - Intronic
1103725349 12:122995033-122995055 TGCTGCCACCAGCAGTGTCGTGG - Intronic
1108542590 13:51457332-51457354 TGCTGCCATCATCACCATCATGG + Intergenic
1108891923 13:55272412-55272434 TGTAGCCTCCAGTACTATCATGG - Intergenic
1114725120 14:24928241-24928263 TGGCTCCCCCAGCACTACCATGG + Intronic
1119259511 14:73229160-73229182 CTGTGCCTCCAGCACTGTCAAGG + Intergenic
1120249125 14:82040824-82040846 TGATGCCAACACCACAATCAGGG - Intergenic
1120808256 14:88775842-88775864 TGTGGCCACCACCACTATGATGG - Intronic
1121528155 14:94633657-94633679 TGCTGCCACCATCAATATGATGG + Intergenic
1124564055 15:30798887-30798909 TGGTGACCCCAGCACCATCCAGG + Intergenic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1132145713 15:99428241-99428263 TGGTGTCACCAGCTAGATCAGGG - Intergenic
1132976599 16:2714174-2714196 TGGTGCCTCCAGCTCCACCAGGG + Exonic
1133926243 16:10194869-10194891 TGATGCCATCACCACAATCAAGG - Intergenic
1134029998 16:10984317-10984339 TAATGCCACCACCACTAACAAGG - Intronic
1139046246 16:63063077-63063099 TGGTTCCAGCAGCCTTATCAAGG - Intergenic
1140071032 16:71649675-71649697 TGCTTCAACCACCACTATCAAGG - Exonic
1140123313 16:72101374-72101396 CGGTGCCACCAGCACTCTGGGGG + Intronic
1140664773 16:77217367-77217389 TGGTGCCCACAGCACTAGCGAGG + Intergenic
1143851224 17:9813533-9813555 TGATGTCAGCAGCAGTATCACGG + Intronic
1148137393 17:45303042-45303064 TGGTCCATCCAGCACTAGCACGG - Intronic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1150852929 17:68722484-68722506 TGGTGCCATCAGGACTTTAAAGG + Intergenic
1151047631 17:70940337-70940359 TAGTGCCACCAGACTTATCATGG - Intergenic
1151839236 17:76605667-76605689 TTATGCCACCAGCTCTATCTTGG + Intergenic
1156791186 18:40976506-40976528 TGGTGGCAGCAGCAGTAGCAAGG + Intergenic
1160046596 18:75392299-75392321 TGGTGGCTCCAGCTCTTTCATGG + Intergenic
1161893851 19:7065079-7065101 TGGTGCCACCACCACAATCGAGG + Intergenic
1164740764 19:30573898-30573920 GGGTGGCACCACCACTGTCATGG - Intronic
925847702 2:8048762-8048784 TGGTTCCACCTGCACTGTGACGG - Intergenic
927186052 2:20483467-20483489 TGGTGCAACTAGAACTATAAGGG + Intergenic
929297980 2:40270250-40270272 TGGTGCCAGAAGCACTACCAAGG + Intronic
933805718 2:85997057-85997079 TGGTGCCCCCTCCACTCTCAAGG - Intergenic
946331006 2:219009425-219009447 AGGAGCCACCACCCCTATCATGG + Exonic
1170574822 20:17654256-17654278 TGCTGCCACCAGTTCCATCATGG - Intronic
1172041202 20:32047260-32047282 TTTTGCAACAAGCACTATCAAGG - Intergenic
1172643443 20:36455496-36455518 TAGAGCCACAAGCACTGTCAGGG - Intronic
1174367684 20:50066385-50066407 TGGGGCCACCAACACTACCAAGG + Intergenic
1174770117 20:53291656-53291678 TGGTCCCACCAGCACAGTCCTGG - Intronic
1176063801 20:63183804-63183826 TGGTGCCACAAGCACCACCAAGG + Intergenic
1177389618 21:20450971-20450993 TGGCCCAACCAGCAATATCATGG + Intergenic
1178720739 21:35007010-35007032 TGGTGCCACCAGCCCCATGTGGG + Intronic
1179616374 21:42586130-42586152 TGCAGCCACCAGCTCTCTCAAGG + Intergenic
1180034881 21:45241465-45241487 TGCTGCCACCACCACTAGCACGG + Intergenic
1181490287 22:23257167-23257189 TGATGCCATCAGCACTATTCAGG + Intronic
1181492638 22:23270016-23270038 TTGTGGCACCTGCACCATCAGGG + Intronic
1182344813 22:29654915-29654937 TGGGGTCACCAGGACTAGCATGG + Intronic
1184306012 22:43602383-43602405 TGGTCTCAGCAGCACCATCAGGG + Intronic
950666153 3:14496352-14496374 TGGTGCCATGAGCACTGTCGTGG - Intronic
950743918 3:15072026-15072048 TGGTGCTACCAGCACGATCCTGG + Exonic
950859762 3:16137642-16137664 TGGTGCCCCCAGCACTTTCTAGG - Intergenic
954461881 3:50631550-50631572 AGGTGCCAGCAGCACTGGCAGGG + Intronic
962796961 3:138857872-138857894 TATTGCCACCACCACTATCCTGG - Intergenic
969220364 4:5754975-5754997 TGGTGCCACCACCACCAGCTTGG - Intronic
970938879 4:21607745-21607767 TGGAGAGACCAGCAGTATCATGG - Intronic
971230395 4:24796505-24796527 TAGTGGCACGATCACTATCACGG + Intronic
975327536 4:73077029-73077051 TGGGTCCTCCAGCACCATCAGGG + Exonic
981068199 4:140507565-140507587 TGCAGCCACAAACACTATCAAGG - Intergenic
990298138 5:54424051-54424073 GTGTGCCAACTGCACTATCACGG - Intergenic
991578963 5:68134385-68134407 TGGCGCCACCAGCACTTTTGTGG - Intergenic
994020342 5:95016531-95016553 TGGTGCCAGAAGCACTCTCAGGG + Intronic
995802199 5:116009312-116009334 TGGTTACACAAGCACTATGATGG + Intronic
996760683 5:126983326-126983348 TGGTGCCTCCGTCCCTATCAGGG + Intronic
999053089 5:148545121-148545143 TGGACCCTCCAGCACTATGAGGG + Intronic
1002107491 5:176887362-176887384 TGGAGCCACAAGCCCTATCCCGG - Intronic
1005181627 6:23113611-23113633 TGGTGCCAGCTGAACCATCAAGG - Intergenic
1005806113 6:29475834-29475856 GAGGGCCACCAGCACTGTCAGGG + Intergenic
1007109168 6:39303266-39303288 TGGTGCCAGCGGCACCTTCAGGG + Intronic
1009913070 6:69957796-69957818 AGGTGCCACAAGCACTTTGAGGG - Intronic
1009985648 6:70778751-70778773 TGCTGCCACCAACACCAGCATGG - Intronic
1012715247 6:102660713-102660735 TGGTGTCACAAGCACTATCTTGG - Intergenic
1013468216 6:110436252-110436274 TGGTGCCACCAGCACTATCAGGG - Intronic
1013688634 6:112614507-112614529 TGGTTCCACCCACTCTATCATGG - Intergenic
1018110310 6:160530806-160530828 TGCTCCCACCAACAATATCAAGG - Intergenic
1018196688 6:161361601-161361623 TGGTGCCCCCACCACTGTCAGGG - Intronic
1019196347 6:170285364-170285386 TGGAGCCACCTGCACCAACACGG - Exonic
1026186378 7:68084821-68084843 TGGTAGCACCAGCAGTATCGAGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029402031 7:100352682-100352704 TGGTCCCCCCAGCACCATCGGGG - Exonic
1030097133 7:105910448-105910470 TGGTGGAACCAACACTAGCATGG - Intronic
1031055377 7:116987544-116987566 TGGTGCCAAGAGCAATCTCATGG - Intronic
1034518659 7:151601876-151601898 CACTGCCACCAGCACTACCAAGG + Intronic
1037819184 8:22127503-22127525 TGGGGCCACCAGCAACACCAAGG - Exonic
1038380606 8:27089656-27089678 TGGGGCCACCAGGACATTCAGGG - Intergenic
1038852192 8:31290479-31290501 TGTTGCCACCACCACAATCCAGG + Intergenic
1040025981 8:42783013-42783035 TGATACCACCACCACAATCAAGG + Intronic
1041229213 8:55731905-55731927 TTGTCCCACCAGCACCATGACGG - Intronic
1044141916 8:88666114-88666136 TGGTGACATCAGCATTTTCATGG - Intergenic
1044918422 8:97141674-97141696 TGCTGCTACCAACACTATCAAGG - Intronic
1046756662 8:117979557-117979579 TGGAGCAACCAGGAGTATCATGG + Intronic
1049925537 9:403355-403377 TGGAGCCACCAGCACATTGAAGG - Intronic
1050077524 9:1880616-1880638 TTCTGCCACCATCACAATCAAGG + Intergenic
1060665017 9:125427636-125427658 GGGTGCCACCATCACTCTCCTGG - Intergenic
1061915951 9:133754235-133754257 TGCTGCCACCACCACCACCAAGG - Intergenic
1186069723 X:5805668-5805690 TGACACCACCTGCACTATCATGG + Intergenic
1186221649 X:7355644-7355666 TGGTGCCAACATTACTATAAGGG - Intergenic
1188550676 X:31361304-31361326 TGATTCCACCAGCATTTTCAAGG + Intronic
1189107250 X:38249714-38249736 TGGTGGCTCCAGCACAATCCTGG + Intronic
1191096651 X:56680124-56680146 TGTTGCCACCAGCTTTGTCAGGG + Intergenic
1191834180 X:65446318-65446340 AGGTGACACAAGCACTATCTTGG + Intronic
1192134782 X:68586872-68586894 TGGTGCCATCAACCCTACCAGGG - Intergenic
1192777064 X:74256177-74256199 TGGTGCCAGCTGATCTATCAAGG + Intergenic
1196233707 X:113255142-113255164 GGGTGCCACAAGCACTCTCGTGG + Intergenic
1200141777 X:153906135-153906157 AGGTGCCACGAACACCATCAGGG - Exonic