ID: 1013469577

View in Genome Browser
Species Human (GRCh38)
Location 6:110449925-110449947
Sequence CAGTGTGGCAGAAGTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 486}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013469577_1013469581 7 Left 1013469577 6:110449925-110449947 CCTTCTCTACTTCTGCCACACTG 0: 1
1: 0
2: 4
3: 65
4: 486
Right 1013469581 6:110449955-110449977 CACAATTCTCTGAACATGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013469577 Original CRISPR CAGTGTGGCAGAAGTAGAGA AGG (reversed) Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
903379395 1:22886306-22886328 AAGTGTGGCAGAAGCAGAAGCGG + Intronic
903745673 1:25585046-25585068 CAGTGTGGCACATGGGGAGATGG + Intergenic
904295673 1:29518294-29518316 CAGTGTGGGAGATGCAGAGGAGG + Intergenic
905395729 1:37665216-37665238 CACTGTGGAAGAAGCAGACAGGG - Intergenic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
906176928 1:43782599-43782621 CAGTGTGGCTGAAGTAAAAGAGG - Intronic
907137594 1:52154417-52154439 CACTGTGGCAGAAATAGAGATGG - Intronic
907571751 1:55490356-55490378 CAGTCTGGCAGCAGTACAGCAGG - Intergenic
907717292 1:56938989-56939011 GAGTGTTGCAGGAGTAGAGGAGG - Intronic
907783061 1:57584897-57584919 CAGTGAGGAAGAAGTAGATGAGG - Intronic
909335930 1:74474014-74474036 CATTGTACCAGAACTAGAGAGGG - Intronic
909956436 1:81784922-81784944 CAATTTGGCAGAAGTAAAAAGGG + Intronic
910306336 1:85768483-85768505 CAGTGAGGAAGAATGAGAGATGG + Intronic
911210497 1:95133761-95133783 CAGTGTGTGAGAATTACAGAGGG - Intronic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
912164993 1:107032440-107032462 CAGAGTGGAAGCAGTAGAGATGG - Intergenic
912540642 1:110412428-110412450 AAGTGGGGGATAAGTAGAGAGGG + Intergenic
912813431 1:112810760-112810782 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
912987320 1:114447001-114447023 CAGTGTAGCTGTAGCAGAGATGG + Intronic
913112600 1:115669982-115670004 CAGTGTGGCATATTTGGAGATGG + Intronic
913198109 1:116474778-116474800 CAGTGAGGCAGATGGAGAGAAGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915285140 1:154847476-154847498 CAGTGTGGCATCAGGAGAGCGGG - Intronic
916166183 1:161969216-161969238 CAGGGTGGCAGCAGCAGGGATGG - Intergenic
916348828 1:163825717-163825739 CAGTGTACCAGAGGTAGGGAGGG - Intergenic
916754192 1:167753098-167753120 GAGTGTGGCAGAAGAAAAGGTGG + Intronic
916844452 1:168634803-168634825 CAGTGTGATATCAGTAGAGATGG + Intergenic
917021402 1:170592298-170592320 CATTGTGACTGAACTAGAGAGGG + Intergenic
917355483 1:174122729-174122751 GAATGTGGGGGAAGTAGAGATGG + Intergenic
917463221 1:175250456-175250478 CAGTGAGGGAGAGGTAGAGTTGG + Intergenic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
917837481 1:178952818-178952840 CAGGGAGGCAGCAGTAGAGGTGG + Intergenic
918354736 1:183696871-183696893 CAGGGTGGTAGAAGTAAAGGTGG - Intronic
918808013 1:189075275-189075297 CAATGTGGCAGATGTAGGGTGGG - Intergenic
918953744 1:191176907-191176929 CAGTGTGGCTAAAGTAGTAATGG - Intergenic
919011068 1:191963746-191963768 CAGTCAAGCAGAAGTAGAAACGG - Intergenic
919800489 1:201351129-201351151 TAGTGTGGGAGAAGGAGAGAGGG - Intergenic
919919769 1:202160987-202161009 CTGTGGGGCAGAAGCAGAGAAGG - Exonic
919989990 1:202702955-202702977 AGGTGTAGCAGAAGCAGAGAAGG + Intronic
920307699 1:205029727-205029749 CCGTGTGGCAGAAGAGGATAAGG + Intergenic
920772208 1:208899674-208899696 CTGGGTGGTAGCAGTAGAGATGG + Intergenic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
922877574 1:228951921-228951943 CAGTGTGGCAGTATGAGAGGCGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923876113 1:238049496-238049518 CAGTGTGGGAGAGGGTGAGAGGG + Intergenic
923891204 1:238216741-238216763 CAGTGGGGAAGGAGTAGAGTAGG + Intergenic
1062935094 10:1379653-1379675 GTGTTTGGCAGAAGTAGAGGAGG + Intronic
1063473441 10:6307604-6307626 CATTGTGGCAGAAAGAAAGAAGG - Intergenic
1063869724 10:10404540-10404562 GAGAGTGGGAGAAATAGAGAAGG + Intergenic
1064614277 10:17136283-17136305 GAGTGGGGAAGATGTAGAGATGG + Intergenic
1064814139 10:19237287-19237309 CAGTGAGGAAGAAGTGGGGAGGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065858974 10:29854848-29854870 CAGTATGGAAGAAGGAGAAAGGG - Intergenic
1066029130 10:31399536-31399558 CAGGGTTGTAGGAGTAGAGATGG - Intronic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067828118 10:49594031-49594053 CAGTGTGGGAGAATCAGGGAAGG - Intergenic
1068513578 10:57997299-57997321 CAATGGGGGAGAAGAAGAGACGG + Intergenic
1068522055 10:58087668-58087690 CAGGGTGGCACAGGCAGAGATGG - Intergenic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069853437 10:71425211-71425233 CAGTGGGGCAGAGAGAGAGAGGG + Intronic
1070073272 10:73110446-73110468 AAGTGTGGCAGAAGCAGCAATGG + Exonic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070696521 10:78568038-78568060 CAGGGTGGCAGCAAGAGAGAAGG - Intergenic
1070868895 10:79730661-79730683 TAGGGTGGCAGCAGTAAAGAAGG + Intergenic
1071003260 10:80855133-80855155 CAGGGTCACAGGAGTAGAGATGG - Intergenic
1071635809 10:87252843-87252865 TAGGGTGGCAGCAGTAAAGAAGG + Intergenic
1071659434 10:87485096-87485118 TAGGGTGGCAGCAGTAAAGAAGG - Intergenic
1071971907 10:90916092-90916114 AAGAGTGGGAGAAGTGGAGAAGG + Intronic
1072368094 10:94734873-94734895 CATTGTGCCAGAAGTACAAAGGG + Intronic
1072443064 10:95474263-95474285 CTGTGTGGCTGAAATAGAAATGG + Intronic
1073394443 10:103206530-103206552 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1073736128 10:106349026-106349048 GGGTGTGGCAGAAGTAGGTATGG - Intergenic
1074026808 10:109644527-109644549 CAGAGTGGCAAATGTAGAAAGGG + Intergenic
1074235160 10:111577531-111577553 CAATGTATCAGAAGTGGAGAGGG - Intergenic
1074243065 10:111658321-111658343 AAGTGTGGGAGCAGGAGAGATGG - Intergenic
1075838864 10:125479927-125479949 TAGTGTGGCCCAAGTAGAGGAGG - Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077594398 11:3519243-3519265 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1077727420 11:4688724-4688746 CACAGTGGTAGCAGTAGAGATGG + Intronic
1077972146 11:7205600-7205622 CAGTCAGGCAGAAGTACAGGAGG + Intergenic
1078041794 11:7871171-7871193 CAGTGCTGCAGAAATAGAGGTGG - Intergenic
1078139306 11:8680521-8680543 CAGTGTAGTAGAAGAAGAGAAGG + Intergenic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078788713 11:14521854-14521876 CAGTGTTGATGAATTAGAGAAGG - Intronic
1081444412 11:43116691-43116713 CAGGGAGGCTGAAGTAGGGATGG + Intergenic
1082262004 11:50083592-50083614 CAGTGGAGCAGAAGGATAGAGGG - Intergenic
1083043734 11:59713329-59713351 CATTGTGGCAGAATGGGAGATGG + Exonic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083680763 11:64350946-64350968 CAGAGAGACAGAAGTTGAGAAGG + Intronic
1084250248 11:67892520-67892542 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1084353915 11:68624214-68624236 CGGTGTTGCAGAAGAAGATAAGG - Intergenic
1084427594 11:69094136-69094158 CAGTGGGGCAGAAGTGGGGCGGG + Intergenic
1084483603 11:69435609-69435631 GAGGGTGGCAGAAGAAGAAAGGG - Intergenic
1084822543 11:71702826-71702848 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
1085201337 11:74703996-74704018 CAGTGGGGATGAAGTAGAGAAGG - Intronic
1085794869 11:79529983-79530005 CAGTGTGGTAGCAGTCAAGATGG - Intergenic
1086014291 11:82147266-82147288 AAGTGTGGAAATAGTAGAGAGGG - Intergenic
1087098963 11:94347041-94347063 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1087188031 11:95222974-95222996 CACTGTGGTAGGAGTACAGATGG - Intronic
1087237060 11:95731785-95731807 GAGGGTGGCAGCAGTAGAGATGG - Intergenic
1087363528 11:97190962-97190984 CAGGATGGTAGCAGTAGAGATGG - Intergenic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1089444912 11:118544198-118544220 TGGGGTGGCAGTAGTAGAGATGG - Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1090951903 11:131480989-131481011 CAGTGGGGTAGAAGTAGGGAGGG + Intronic
1092029708 12:5274160-5274182 CCTTGTTGCAGAAGAAGAGATGG + Intergenic
1092420571 12:8328032-8328054 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1092996878 12:13959196-13959218 GAGTTTGGCAAAAGGAGAGAAGG + Intronic
1093401218 12:18748927-18748949 CATTATGGCAGAAGTAGAATTGG + Intergenic
1094133695 12:27101924-27101946 CAGGGTGTGAGCAGTAGAGATGG - Intergenic
1094183839 12:27620043-27620065 CAGGGTGTGAGCAGTAGAGATGG - Intronic
1094325206 12:29230633-29230655 CAGTTTGGTACAAGCAGAGATGG + Intronic
1094384350 12:29877825-29877847 AAGTGTGGTAAAAGAAGAGAGGG - Intergenic
1095305642 12:40635940-40635962 CAGTGTTGAAGAAGAAGTGAAGG + Intergenic
1096164182 12:49407159-49407181 CTGAGTGGTAGCAGTAGAGAGGG - Intronic
1096179032 12:49540523-49540545 GAGCCTGGCAGAAGTAGAGGTGG + Intronic
1096409647 12:51367920-51367942 CAGGGTGGCAGAAGCACAAAGGG + Intronic
1096497132 12:52045165-52045187 AGGAGTGGGAGAAGTAGAGATGG + Intronic
1096504302 12:52082893-52082915 CAGAGTGGCAGCAGGAGAGCAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1098236718 12:68424689-68424711 CAGGGTGGCAGCAGTAGAGGAGG + Intergenic
1099348840 12:81539003-81539025 CAGGGTGGCAGCAATAGAGGTGG + Intronic
1100762700 12:97826880-97826902 TCATGTGGCAGAAGGAGAGAGGG - Intergenic
1101014406 12:100484659-100484681 CAGCGTGGCGTCAGTAGAGATGG - Intronic
1101059908 12:100959949-100959971 CAGGATGGCAGAAGTGGAGGAGG + Intronic
1101273811 12:103177233-103177255 CATTGTGTCAGAAGCTGAGATGG - Intergenic
1101307978 12:103549180-103549202 CAATGTGATAGAAATAGAGAAGG - Intergenic
1102443236 12:112979400-112979422 AAGTGTGGCAGCAGCAGAGAAGG - Intronic
1104551078 12:129757864-129757886 CAGTATGGCAGACATAGAGAGGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104803965 12:131573247-131573269 AACTGAGGCAGAAGCAGAGAAGG + Intergenic
1105648273 13:22344843-22344865 CAGAAAGGCAGAAGTAGGGAGGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1106286691 13:28324244-28324266 TACTGAGGCAGAAGCAGAGAGGG + Intronic
1106524449 13:30527618-30527640 CAGTGTGACACAAAAAGAGATGG + Intronic
1106810268 13:33351885-33351907 AAGTGTAGCAGAAGTGTAGAGGG - Intergenic
1107269928 13:38603170-38603192 AAGAGAGGCAGAAGTGGAGAAGG - Intergenic
1107997966 13:45879505-45879527 TGGTGTGGCAGAAGCAGGGAGGG + Intergenic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1108520212 13:51240241-51240263 AAATGTGGAAGAAGGAGAGAAGG - Intronic
1108834409 13:54523336-54523358 CAGTGTGACATAACTAGAGATGG - Intergenic
1110066248 13:71110069-71110091 CAGTGAGGCAGAAGAAAAGGGGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110978344 13:81867493-81867515 CAGTGTTGCAGAAGAAGATAAGG - Intergenic
1111503220 13:89152744-89152766 AATTGTGGCTGAAGTAGAAAGGG - Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112673839 13:101674332-101674354 CAGGGTGGCAAAAGAAGACAAGG - Intronic
1112812798 13:103237936-103237958 CATTGTGATAGAAGTAGGGAAGG + Intergenic
1114253826 14:20984906-20984928 AAGTGTTGCAGATGCAGAGATGG - Intergenic
1114835959 14:26203445-26203467 CAGTGAGGCAGAGGTTGAGATGG - Intergenic
1115086118 14:29516873-29516895 GAGTGTGGCAGATATAGAAATGG - Intergenic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1115708848 14:36027943-36027965 CAGTGTACCAGAAATAGAAATGG - Intergenic
1116276535 14:42840586-42840608 AATTGGGGCAGAAGTGGAGATGG - Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1116996693 14:51332173-51332195 AAGTGAGTCAGAAGGAGAGAGGG + Intergenic
1117733584 14:58747744-58747766 CTTTGTAGCAGAAGGAGAGAGGG - Intergenic
1118788470 14:69066752-69066774 AAGTGGGCCATAAGTAGAGAAGG - Intronic
1118884275 14:69853517-69853539 CACTGTGGGAGAACTTGAGATGG + Intergenic
1118937436 14:70300548-70300570 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
1119417606 14:74484332-74484354 CAGTGGGCAAGAAGCAGAGATGG - Intronic
1119670897 14:76517580-76517602 GAGTGAGGCAGAAGAAGAAAGGG - Intergenic
1120173777 14:81272331-81272353 CAGGGTGACAGGGGTAGAGAGGG + Intronic
1120275097 14:82363080-82363102 TAGTGGGGGAGAAGTAAAGAAGG - Intergenic
1120499019 14:85270777-85270799 CTGTGTGTCAGACGTTGAGAGGG - Intergenic
1120702151 14:87709990-87710012 TATTGTGGCTGAAGTAGAAAAGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121352357 14:93184131-93184153 CAGTGTGGCAGAAATCGAGGAGG - Exonic
1123068293 14:105628952-105628974 GAGTGTGGCAGCAGGACAGAAGG - Intergenic
1124840240 15:33234709-33234731 CTGTGAGGCAGAAGTGGACAGGG + Intergenic
1125195742 15:37043985-37044007 CAGTGTGGATAAAGAAGAGACGG - Intronic
1125660752 15:41392958-41392980 CAGGGTGGGAGTAGAAGAGATGG + Intronic
1125919806 15:43518639-43518661 CAGTGAGGCAGAAGGGGAGGGGG - Intronic
1125968717 15:43894700-43894722 CAGAGTGGAAGAAGCAGAGGGGG - Intronic
1126251788 15:46575783-46575805 CAGTGTTACAGGAATAGAGAAGG - Intergenic
1126404826 15:48313287-48313309 CAGAGAGGCAGAAGTGGAGATGG - Intergenic
1126482681 15:49143472-49143494 CAGAGTAGCAGAGGTAGAAATGG + Intronic
1127156598 15:56134172-56134194 CAGTGTGACAAAACTAGTGAGGG - Intronic
1127484389 15:59405765-59405787 CAGTGTGGGAGAAAGAGGGATGG - Intronic
1127862821 15:63008653-63008675 CAGTGTGACAGGAGCTGAGATGG + Intergenic
1128079665 15:64848841-64848863 CAGCATGGCAAAAGTAGAGCAGG - Intronic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128706404 15:69840311-69840333 GAGTGTGGGAAGAGTAGAGAGGG - Intergenic
1128715399 15:69904208-69904230 CATTGTGTCAGAATTAGGGAAGG + Intergenic
1129614659 15:77088899-77088921 GAGTGGGACAGAATTAGAGAAGG - Intergenic
1129647266 15:77448103-77448125 CAGAATAGCAGTAGTAGAGATGG - Intronic
1129879695 15:78998589-78998611 CAGTGGGGCAGCAGAAGGGAGGG - Intronic
1130026775 15:80277086-80277108 CAGTGTGCCAGATGCAGACACGG + Intergenic
1130232925 15:82110150-82110172 GAGTGTGACAGGAGGAGAGAAGG - Intergenic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131547754 15:93330135-93330157 GCGTGAGGCAGAAGAAGAGATGG + Intergenic
1132291858 15:100709423-100709445 GAGTGAGGAAGGAGTAGAGAGGG + Intergenic
1133359287 16:5161086-5161108 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1133602272 16:7351084-7351106 TATTTTAGCAGAAGTAGAGAAGG + Intronic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133869739 16:9675848-9675870 CAGTGTTGCAGAAGAAAATAAGG + Intronic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1135932197 16:26747658-26747680 GAGTGAGGGAGAAGAAGAGAGGG - Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137913963 16:52408090-52408112 CAGTGTTCAAGAAGAAGAGATGG + Intergenic
1140250259 16:73288895-73288917 CAGTCTTGCTGAAGAAGAGAGGG - Intergenic
1140384325 16:74521170-74521192 CACTGTGGCTTAAGTAGAGGTGG + Intronic
1140474873 16:75234845-75234867 CAGCGTGGCAGAAGAGGAGCCGG + Intronic
1141406975 16:83803151-83803173 CAGTGTGGCAGAGTTAGTGAAGG - Intergenic
1143071197 17:4294982-4295004 CAGAGTGGGGGAAGGAGAGACGG + Intronic
1143891337 17:10104793-10104815 CAGCATGGCAGCAGTGGAGAAGG - Intronic
1143903090 17:10189292-10189314 CAGGGTGGTGGAAGTGGAGATGG - Intronic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1146506869 17:33413470-33413492 CAGAGTGGCAGCAACAGAGAGGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147974880 17:44241394-44241416 CACTTTGGCAGAAGAAGAAAGGG - Intergenic
1150365597 17:64581336-64581358 GAGTGTGGCTGAAGCAGAGTGGG - Intronic
1151451352 17:74200163-74200185 CAGTGTGGCAGAGGTAAGGAGGG - Intergenic
1152818223 17:82421458-82421480 CCGCGTGGCAGCAGTAGAGGAGG + Intronic
1153092511 18:1364171-1364193 GAGTGTGGGGGAAGTAGCGATGG - Intergenic
1153363111 18:4221406-4221428 CAGTGAGGCAGCAATAGAGAGGG - Intronic
1153764116 18:8359207-8359229 CACTGTGGCAGCATGAGAGATGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155939657 18:31790768-31790790 CAGGGTGGCAGCAGGAGTGAGGG + Intergenic
1156257478 18:35411444-35411466 AAGTGCTGCAGAAGTAGACAGGG + Intergenic
1156974279 18:43198159-43198181 GAGTGAGGCTGAAGTAGGGAAGG - Intergenic
1157640077 18:49203459-49203481 CTGTGTGAAAGAAGTAGACATGG + Intronic
1157649844 18:49317412-49317434 CAGGGGTGCAGAAGTAGAGAAGG + Intronic
1157906537 18:51574427-51574449 CGGTGTTGCAGAAGAAGATAAGG + Intergenic
1158536780 18:58315371-58315393 CAGTATGGTAGATGTGGAGAGGG + Intronic
1158900100 18:61954484-61954506 GAGGGTGGCAAAAGCAGAGAGGG + Intergenic
1159014915 18:63093437-63093459 CACGGTGGCAGAGGCAGAGATGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160083237 18:75751095-75751117 CAGAGTGACAGAGGCAGAGACGG - Intergenic
1161956602 19:7499409-7499431 AAGTGTGGCAGAAACGGAGATGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163900417 19:20095354-20095376 CAGTGTTGCAGAAGAAAATAAGG + Intronic
1163920832 19:20287021-20287043 CAGTGTGTCAGAAGTATAAATGG + Intergenic
1164258629 19:23550588-23550610 CAGTGTTGCAGAAGAAAATAAGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165054065 19:33162552-33162574 CACTGTGGCTTAAGCAGAGAAGG - Intronic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1166122384 19:40693400-40693422 CAGTGTGGGAGACAGAGAGATGG - Intronic
1166213803 19:41323278-41323300 GAGTGAGGCAGAAGGAGAGATGG - Exonic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166730758 19:45057795-45057817 CACGGTGGCCGAGGTAGAGAAGG + Exonic
1167496666 19:49823255-49823277 CAGTATGGCAGAAGTGGACTTGG - Intronic
1168456838 19:56518580-56518602 GAGTGTGGAAGAACCAGAGAGGG + Intronic
925223855 2:2164907-2164929 CACTGTGACAGAAGGAAAGAAGG + Intronic
925268451 2:2583840-2583862 CACTGATGCTGAAGTAGAGATGG + Intergenic
926266418 2:11326255-11326277 CCATTTGGCAGAAGAAGAGAAGG + Intronic
927407784 2:22791747-22791769 CAGTGAGGAAGAGGTAGAAAGGG - Intergenic
927495393 2:23548586-23548608 CACTGTGGCAAAAGGAGAGATGG - Intronic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
928762917 2:34605825-34605847 AAGTGGGGCAGAAGGACAGAAGG + Intergenic
929279463 2:40062103-40062125 CAGGGTGGCAGCAGTAGGGAAGG - Intergenic
929618617 2:43332356-43332378 GTGTGTTGCAGAAGCAGAGAAGG - Intronic
931622307 2:64223191-64223213 CAGTCTGGCACAAGAAGAGGAGG + Intergenic
933485332 2:82914894-82914916 CAGTGTGTCAGATGTAGAAAAGG + Intergenic
933581585 2:84132742-84132764 CAGTGTAGGATAAGTAGTGATGG - Intergenic
934527254 2:95059509-95059531 CACTGAGGCAGAGGGAGAGACGG + Intergenic
934715021 2:96538106-96538128 TGGTGTGGCAGAGGTAGAAAGGG + Intronic
936460548 2:112711176-112711198 CAGAAAGGCAGAAGGAGAGAAGG - Intergenic
936468161 2:112772843-112772865 CAGTAAGGAAGAAGAAGAGATGG + Intergenic
936510796 2:113144235-113144257 GAGTGAGGAAGAAGTAGGGATGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
940044742 2:149397512-149397534 AGGAGTGGCACAAGTAGAGAGGG + Intronic
940055550 2:149509156-149509178 CAGTGTGGCAGAAGTTAGGAGGG + Intergenic
940919038 2:159287139-159287161 CAGGGTGGCCGAAATAGAGAAGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941456328 2:165714849-165714871 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
942340792 2:174943640-174943662 CACTGTGGAGGAAATAGAGATGG - Intronic
942919996 2:181361485-181361507 CAGTGTTCTAGAAGTACAGAGGG + Intergenic
943089822 2:183360746-183360768 CTGTGTGGGAGCAGGAGAGAGGG + Intergenic
944142657 2:196474364-196474386 CATTTTGGCAGAAGTAGAAATGG + Intronic
945136944 2:206639624-206639646 AAGGGTGGCAGCAGTGGAGAGGG - Intergenic
945800614 2:214425195-214425217 CAGTTTGAGAGAAGTAGAAAGGG - Intronic
945912184 2:215661931-215661953 AAGATTGGCTGAAGTAGAGAAGG - Intergenic
945998886 2:216464160-216464182 CAGCTTGGCAGAAGAAAAGAGGG + Intronic
946179835 2:217942653-217942675 CAATGTGGCAGCAGTGGGGAAGG - Intronic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947446951 2:230171563-230171585 CAGCGTGGCAGCAGTGGAGCGGG - Intronic
947806876 2:232975263-232975285 AAGGGTGGCAGAAATAGTGAGGG + Intronic
947879076 2:233489314-233489336 CAGTGCGTCAGCAGCAGAGAGGG + Intronic
948230606 2:236346455-236346477 CAGTGTGGCAGAAGCAGGACTGG + Intronic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
1168930754 20:1621576-1621598 CAATGTGGCAGATGCACAGAGGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169975141 20:11316801-11316823 CAGTGTGACAGGAATAGAAAGGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170703172 20:18722339-18722361 CAGTGTTGAAAAAGCAGAGATGG + Intronic
1170994278 20:21336991-21337013 CAGTGTGGAAGGAGCAGAGGAGG + Intronic
1172304081 20:33869349-33869371 CAGTGCGGCGGAAGCAGGGAAGG + Intergenic
1172848363 20:37943918-37943940 CAGTGGGGGAGAAGAAGAGTCGG - Intronic
1172932662 20:38597454-38597476 CAGTGTTGCAGAAGAAGATAAGG + Intergenic
1172972363 20:38882943-38882965 CAGTGTGGCTGAACCAGTGAGGG + Intronic
1173946092 20:46952136-46952158 CAATGGGGCAGGAGTAGTGAGGG + Intronic
1174031495 20:47632094-47632116 CAGTCAGTCAGAAGTACAGAAGG - Intronic
1174080992 20:47970675-47970697 CAGTGGGGCAGAGAGAGAGATGG - Intergenic
1174288394 20:49488846-49488868 CAGTGTGGCTGAAATAGAGCAGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1174828232 20:53788669-53788691 GAGGGTGGGAGAAGGAGAGAGGG - Intergenic
1175118309 20:56699622-56699644 CAGTGTGGGTGAAATAGACATGG - Intergenic
1176205808 20:63887533-63887555 AAGCATGGCAGAAGCAGAGAAGG - Intronic
1177731551 21:25033793-25033815 CACTGTGGCAGAGTTAGAGGTGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179039385 21:37788612-37788634 GAGTGTGGCAGAAGTGAAAAAGG + Intronic
1179570658 21:42276853-42276875 CAGTGTGGAAGCAGAACAGACGG - Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181630664 22:24149499-24149521 CAGTGGGGGAGAAGGTGAGATGG + Intronic
1181899885 22:26145038-26145060 CAGTGTGGCAGAGCCAGATATGG + Intergenic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182009983 22:26992555-26992577 CAGTGAGGCAGTAGTAGACCTGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1183875116 22:40773658-40773680 CAGGGTGACTGAAGTATAGAAGG + Intronic
1184900322 22:47442746-47442768 CAGTGCTGCAGATGAAGAGATGG - Intergenic
950121752 3:10486443-10486465 TGATGTGGAAGAAGTAGAGAGGG - Intronic
951366857 3:21793885-21793907 CAGTTTTGCAGAAGAAGAGAAGG - Intronic
951871830 3:27370212-27370234 CAGTATGGCAGAGCTAGTGATGG + Intergenic
952531405 3:34265789-34265811 CAGTGTGGCAGATGGTGATAAGG + Intergenic
952895396 3:38075394-38075416 CAGTGTTGCAGAAGAAAATAAGG + Intronic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953384993 3:42501435-42501457 CCGTGTGACAGAAGGAGAGGCGG - Intronic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953518045 3:43616289-43616311 CGGTGTGGCAGAAGCAGAACTGG + Intronic
953825833 3:46250632-46250654 CAGTGTTGCAGAAGAAAATAAGG + Intronic
954887145 3:53885164-53885186 CAGTGTTTCAGAAGTTGAAAAGG + Exonic
955982454 3:64540655-64540677 CAGTGTGGGGGAAGCAGAGCTGG - Intronic
956532963 3:70241856-70241878 CAGTGTGTAAGTAGTAGAGATGG + Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956789775 3:72671649-72671671 GAGTGAGGGAGAAGGAGAGAGGG - Intergenic
956907084 3:73777579-73777601 CAGTGTAGTAGCAGTAGAAATGG + Intergenic
957064533 3:75510608-75510630 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
957512633 3:81209118-81209140 CAGAGAGACAGAATTAGAGAGGG - Intergenic
957950373 3:87118176-87118198 CACTTTGGCAGAACTAAAGAGGG - Intergenic
958163120 3:89843227-89843249 GAATGCAGCAGAAGTAGAGAGGG + Intergenic
958530082 3:95317039-95317061 CAGTGTGGAAGAGAGAGAGAGGG + Intergenic
958896846 3:99838973-99838995 CAATGTGGATGAAGTTGAGATGG - Intronic
959012580 3:101095352-101095374 CATTGGGGCATAAATAGAGATGG + Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960381916 3:116973201-116973223 CCGCGTGGCAGAAGGGGAGAGGG - Intronic
961074540 3:123969649-123969671 CAGTGGAACAGAAGTGGAGAAGG - Intronic
961238236 3:125387167-125387189 CAGAATGGAAGAAGTAGAGGTGG + Intergenic
961288821 3:125828792-125828814 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
961369601 3:126421496-126421518 AAGGGTGGCAGAAGCAGGGATGG + Intronic
961898249 3:130187234-130187256 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
962007013 3:131359875-131359897 AGGTGAGGCAGAAGCAGAGAGGG + Intergenic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
962526450 3:136241937-136241959 CTGAGGGGCGGAAGTAGAGAAGG + Intergenic
963350533 3:144145981-144146003 TAGTAAAGCAGAAGTAGAGAAGG - Intergenic
963521488 3:146363399-146363421 CAGTGTTGCAGAAGAAGATAAGG - Intergenic
963638424 3:147828586-147828608 CAGTGTGGAGGATGTATAGACGG + Intergenic
963966984 3:151382974-151382996 CACTGGGGTAGAGGTAGAGAAGG - Intronic
964125598 3:153231072-153231094 CGGTGTTGCAGAAGAAGATAAGG + Intergenic
964261911 3:154849019-154849041 CAGTGTGGAAAAGGTGGAGAAGG + Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965070197 3:163908912-163908934 CGGTGTTGCAGAAGAAGATAAGG - Intergenic
965329683 3:167356025-167356047 CAGTATGACACAAGTAGATAGGG - Intronic
966030856 3:175346211-175346233 CTGTGTGGCAGAATTTCAGAAGG - Intronic
966066711 3:175829078-175829100 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
966242969 3:177775047-177775069 TAGAGTGGCAGAAGGAGAAACGG + Intergenic
966715589 3:183010431-183010453 CTGTGTGGTAGAAGAGGAGATGG - Intergenic
967264011 3:187674186-187674208 CAGAGTGGTTAAAGTAGAGAGGG + Intergenic
967388772 3:188934989-188935011 AACTTTGGCAGAATTAGAGAGGG + Intergenic
967756772 3:193178892-193178914 CATTATGGCTAAAGTAGAGAAGG - Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967943846 3:194786905-194786927 CAGAGGGGCGGCAGTAGAGAGGG + Intergenic
968310796 3:197681716-197681738 TGGCGTGGCAGAAGTAGGGAAGG - Intronic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969039096 4:4280586-4280608 GAGTGTGACAGCAGCAGAGACGG + Intronic
969423706 4:7111726-7111748 CAGTGTGGCAGCAGTGGTGAAGG + Intergenic
969455210 4:7296457-7296479 CAGGGTGGCAGAGACAGAGAGGG + Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
970887781 4:21006656-21006678 GAGTGTTTCAGAAGTAAAGATGG + Intronic
970916267 4:21338804-21338826 CTGAGTGGCAGAATCAGAGAAGG - Intronic
971742276 4:30535889-30535911 CAGGGTGGTAGCAGTAAAGATGG - Intergenic
972363022 4:38346280-38346302 AATTGTGGCAGAAGGAGAAAGGG - Intergenic
972450812 4:39196557-39196579 CATGGTGGCAGCAGTAGAGATGG - Intronic
972924021 4:43981566-43981588 CAGTGTGGGAGAGGGAGAGAAGG - Intergenic
973088959 4:46107491-46107513 CAGGGAGGAAGAAGAAGAGAAGG - Intronic
973268010 4:48230729-48230751 GAGTGTGGTGGAAGTAAAGATGG - Intronic
973550094 4:52025502-52025524 CAGTGTGGAAGAAGCACGGAGGG + Intronic
973553482 4:52058505-52058527 CAATGTGGCAGAGGCACAGAAGG - Intronic
973936586 4:55852902-55852924 CAGTGTGGTAGGACTAGACAAGG - Intergenic
973958632 4:56087970-56087992 CATGGTGACAGAAGGAGAGATGG - Intergenic
974290896 4:59928819-59928841 CAGTGTGGCAGCAGTACCAAAGG + Intergenic
974871142 4:67644452-67644474 CAGTTTCACAGTAGTAGAGAAGG + Intronic
975721811 4:77255605-77255627 TAGTGTGGCAAAAATACAGAAGG - Intronic
976359010 4:84155507-84155529 GGTTGTGACAGAAGTAGAGAAGG + Intergenic
977041882 4:92027198-92027220 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
977446572 4:97138984-97139006 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
978098907 4:104812916-104812938 CATTGTTTCAGAAGTTGAGAGGG - Intergenic
978356597 4:107881735-107881757 CAGGGCGGGTGAAGTAGAGATGG - Intronic
979649625 4:123114780-123114802 CACTGTGGGAGATGCAGAGAAGG - Intronic
979997820 4:127453694-127453716 GAATGTGTCAGAAGGAGAGAAGG + Intergenic
980112061 4:128645186-128645208 CGGTGTTGCAGAAGAAGATAAGG + Intergenic
980765577 4:137299668-137299690 CAGTGTGGCAGAAAAAAAAAGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981238316 4:142443876-142443898 AAGTGGGGCAGAAGAGGAGAAGG + Intronic
981598402 4:146454480-146454502 CAGTGTGGATGTAATAGAGAGGG - Intronic
982353747 4:154444525-154444547 CAGGGTGGTAGAAGTGGAGGTGG - Intronic
983055352 4:163094457-163094479 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
983564812 4:169138554-169138576 CAGTGAGTAAGAAGTAGAGGAGG + Intronic
985035143 4:185831265-185831287 AAATGTGGCAGAAGAAGAGCGGG + Intronic
985582221 5:704143-704165 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
986404832 5:7415580-7415602 CAGTGTCACAGAAGTAGGAAGGG - Intronic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
989050368 5:37314197-37314219 CATTGTGGCAGAACTTCAGAAGG - Exonic
989419496 5:41219954-41219976 GAGTGTGGCCAAAGTAAAGAGGG + Intronic
989557884 5:42818274-42818296 CAGTGTTGCATAGCTAGAGAAGG + Intronic
991357012 5:65779051-65779073 AAGTGGGGCAGAGGTAGAAAGGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
991934595 5:71789412-71789434 CAGGGTGGTAGCAGTGGAGATGG + Intergenic
992210736 5:74477577-74477599 CAGAGTGGGAGAAATAGATATGG + Intergenic
992421534 5:76611223-76611245 CTGGGTGGCAGAGGGAGAGAAGG + Intronic
992783064 5:80145416-80145438 CTGTGTGGGGGAAGTAGAGGCGG + Intronic
993042730 5:82834072-82834094 CAGGGTGGAAGGAGCAGAGAGGG + Intergenic
993971240 5:94422383-94422405 CAGTGGGGCAGAAGTATAATTGG - Intronic
994036652 5:95209399-95209421 AGGTGTGACAGAAGGAGAGAGGG - Intronic
995125345 5:108573177-108573199 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
995641286 5:114260083-114260105 TAGGGTGGTAGAAGTGGAGATGG - Intergenic
996582824 5:125050466-125050488 GAATGTGGCAGAAGGAGAAATGG + Intergenic
998032980 5:138889229-138889251 GAGTGTGGCAGCTGAAGAGAGGG + Intronic
998350268 5:141495740-141495762 CAGGGAGGCAGAGATAGAGAAGG - Intronic
998915864 5:147010846-147010868 CAGGGTGGCAGCTGTAGAGTAGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
1000790961 5:165606741-165606763 CAGTGTGGTAATAGTAGAGGCGG - Intergenic
1000906818 5:166974420-166974442 CAGGGAGGCAGATGTAGGGAGGG - Intergenic
1003688022 6:8323712-8323734 CAGTGTGGCAGGAGAAGGGCAGG - Intergenic
1003820371 6:9889648-9889670 CAATGTGGCAGAATTAAACAAGG - Intronic
1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG + Intergenic
1004019000 6:11759397-11759419 AAGTGTGGTAAAAGTAGAAAAGG - Intronic
1004057426 6:12154187-12154209 CACTGTGGGTGAAGAAGAGAAGG - Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005166597 6:22929087-22929109 CAGAGTGGTAGAAATGGAGAGGG + Intergenic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1005317286 6:24615867-24615889 CCGTGAGAGAGAAGTAGAGAAGG - Intronic
1007568082 6:42868782-42868804 CTATGTGGCAGGAGTAGGGATGG - Intergenic
1008054403 6:46931387-46931409 CTGTGATGCAGAAGTAGGGAGGG - Intronic
1008130262 6:47713163-47713185 CTGGGTGGCAGAGGTAGGGATGG - Intronic
1008901833 6:56628211-56628233 GAGGGTGGAAGATGTAGAGATGG + Intronic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1010065018 6:71672500-71672522 CAGTGTGGCAAAAGAAAAAAAGG - Intergenic
1010385663 6:75276841-75276863 CAATATGGCTGAAGTAGAGGGGG - Intronic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1011388495 6:86823619-86823641 CAGAGTGACAGCAGTAGACAGGG - Intergenic
1011895996 6:92226263-92226285 CAGAGAGGAAGAAGGAGAGATGG - Intergenic
1012796921 6:103774112-103774134 CATTGTGGCAAATGTAGAGGGGG - Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015318419 6:131843848-131843870 GAGTGTGGAAGGAATAGAGAGGG - Intronic
1016524898 6:144990561-144990583 CTGTGAGGCAGAAGCAGAGAGGG + Intergenic
1016822753 6:148361790-148361812 CAGTGTGGAAGAAGAAGACAGGG + Intronic
1017037761 6:150281806-150281828 CAGTGTAGAATCAGTAGAGATGG - Intergenic
1017269676 6:152491535-152491557 CAGTGTTGCAGAAGAAAATAAGG - Intronic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1017777409 6:157690973-157690995 CCAGGTGGCAGAAGTCGAGAAGG - Intergenic
1018163815 6:161075006-161075028 CTCTGTAGTAGAAGTAGAGAAGG + Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019849853 7:3543984-3544006 CAGTTGAGCAGTAGTAGAGATGG - Intronic
1020428383 7:8094975-8094997 CAGTGTGGCATAAGAAGAAATGG + Intergenic
1021253257 7:18358016-18358038 GAATGTGGCAGAAGTTTAGAAGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023329230 7:39096517-39096539 GAGTCTGGCAGAAGAAGCGAGGG + Intronic
1025688403 7:63739014-63739036 CAGTGGAGCAGAAGGATAGAAGG + Intergenic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1025929609 7:65983078-65983100 CCGTGTGGGAGAGGTAGAGGAGG + Intergenic
1027203711 7:76080434-76080456 TAGTGGAGCAGAAGGAGAGAGGG - Intergenic
1028590042 7:92484176-92484198 CAGTGTTGCAGAAGAAAATAAGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030498373 7:110328552-110328574 AATTGTGTCAGAAGTAGTGATGG + Intergenic
1030544104 7:110870996-110871018 CAGTGAGGCAGCAGTAGAGATGG + Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032975569 7:137218724-137218746 AAATGTGGCAGAAATAGAGTGGG + Intergenic
1035456313 7:159011239-159011261 CTGTGTGGAAGAGGCAGAGAAGG + Intergenic
1035975684 8:4308087-4308109 AACAGTGGCAGAAGTGGAGAGGG + Intronic
1036020951 8:4845636-4845658 CAGTGTTGAAGAAGCACAGACGG + Intronic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036587676 8:10139844-10139866 CTGAGTGTAAGAAGTAGAGAAGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038275740 8:26119218-26119240 CAGTGTGGCAGTGGGAGATAAGG + Intergenic
1038579815 8:28738233-28738255 CAGGATGGAAGAGGTAGAGAGGG - Intronic
1040468156 8:47714210-47714232 CTGGGTGGCAGAGGTAGAGAAGG + Intronic
1041618325 8:59934433-59934455 CAGTGTGGCAGGAGCATAGTTGG + Intergenic
1041875611 8:62683713-62683735 GGGTGGGGCAGAAGGAGAGAGGG - Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1044415338 8:91932623-91932645 CATTCTGGCAGAAGTAAAGGTGG - Intergenic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045135663 8:99214705-99214727 TAGTGTGACAGAAGTAAAGATGG - Intronic
1045287826 8:100807219-100807241 CGGTGAGTCAGAAGTAGAGCAGG + Intergenic
1045799042 8:106080263-106080285 CTGGGTGCCAGGAGTAGAGAAGG - Intergenic
1046353212 8:113043552-113043574 CAGTGTGGATGAAATAGGGAAGG - Intronic
1046493730 8:114986530-114986552 CATTGAGGCAGAAGTATAAATGG - Intergenic
1047856239 8:128915759-128915781 CGGTGTTGCAGAAGAAGATAAGG - Intergenic
1048223765 8:132566026-132566048 CAGTGTGGGAGAGGTGGAGTGGG + Intergenic
1048509493 8:135049475-135049497 GAGAGAGGCAGAAGCAGAGAGGG + Intergenic
1048526663 8:135209000-135209022 CTGTCTAGCAGAAGTGGAGAAGG + Intergenic
1049673454 8:143879591-143879613 CAGTGTGGCAGGTGTGGACAGGG - Intergenic
1049768429 8:144366883-144366905 CAGTGTGGCAGTATTGGAGGTGG - Intergenic
1050821280 9:9882939-9882961 CAGTGAGGGAGAAAGAGAGAAGG - Intronic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1051710930 9:19929797-19929819 CAGTGGGACAGATGTAGAGGTGG + Intergenic
1052653192 9:31327731-31327753 CAGTGTTGCAGAAGAAGATAAGG - Intergenic
1052884509 9:33630929-33630951 CAGAGTGTCAGTAGTAGGGAAGG + Intergenic
1052913590 9:33906454-33906476 CAGCATGGGAGAAGTAGAAAGGG - Intronic
1052926372 9:34020238-34020260 CAGTGGGACAGATGTGGAGATGG - Intronic
1053189518 9:36050452-36050474 TAGGGTGGCAGCAGTGGAGATGG - Intronic
1054827560 9:69588351-69588373 CAGAGTGGTAGCAGCAGAGATGG + Intronic
1054845191 9:69787628-69787650 CAGTGTGCTAGAAGTAGGGATGG + Intergenic
1055354317 9:75421897-75421919 CAGAGTGGGAAAAGAAGAGAAGG + Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1059591981 9:115671773-115671795 CAGAGTGACAGCAGTAGAGATGG + Intergenic
1059735013 9:117091963-117091985 TAGGATGGCAGCAGTAGAGAAGG + Intronic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1061373823 9:130212642-130212664 CAGCGTGTCTGAAGGAGAGAGGG + Intronic
1061390473 9:130314905-130314927 CAGTGAGGCAGAGGCAGAGTGGG + Intronic
1061676076 9:132216521-132216543 CAGTGGGGCAGGGGTGGAGAGGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1185891846 X:3828811-3828833 CAGTGTGGAAGAAGATCAGAGGG - Intronic
1185896953 X:3867225-3867247 CAGTGTGGAAGAAGATCAGAGGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1188722104 X:33535099-33535121 CTGTGTGGCAGTAGCAGAGGGGG + Intergenic
1189422234 X:40866443-40866465 CCATGTGGCCAAAGTAGAGATGG - Intergenic
1189842495 X:45095500-45095522 TATTGTTGCAGAAATAGAGAAGG + Intronic
1190388454 X:49908438-49908460 CAGTGTGGCAGTGGTAGAGAAGG + Intergenic
1190466650 X:50731289-50731311 CTGGGTGGAAGAAGGAGAGAGGG - Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1192320870 X:70089549-70089571 GAGGGAGGCAGAAGGAGAGAGGG - Intergenic
1192320878 X:70089583-70089605 GAGGGAGGCAGAAGGAGAGAGGG - Intergenic
1192537343 X:71939357-71939379 CACTGTGGAAGCAGTATAGAAGG + Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195056263 X:101148405-101148427 CAGTGTGGCAAAATGAGAAAAGG + Intronic
1195394946 X:104400176-104400198 CTGTTTGGCAGAAGTATAAATGG - Intergenic
1195623005 X:106976941-106976963 TAGTGTGGGTGAAGTAGAGATGG - Intronic
1195636468 X:107121482-107121504 AAGTTTGGCAGAATTAGAAATGG - Intergenic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1197181623 X:123542982-123543004 CAGAGTGGTAGCAGTAGAGGTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198994601 X:142560068-142560090 CAGTGTTGTAGCAGCAGAGATGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1201697164 Y:16838725-16838747 CAGTGTTGCATAGCTAGAGAAGG + Intergenic
1201936955 Y:19419935-19419957 CAGTGTTGCAGAAGAAAATAAGG - Intergenic
1202076352 Y:21041417-21041439 CAGCTTGGCTGAAGTAGTGAGGG + Intergenic
1202076696 Y:21043811-21043833 CAGTGTTGCAGAAGAAAATAAGG + Intergenic