ID: 1013470034

View in Genome Browser
Species Human (GRCh38)
Location 6:110455841-110455863
Sequence CAGTGTCCTCACATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4769
Summary {0: 2, 1: 14, 2: 383, 3: 1258, 4: 3112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013470034_1013470039 10 Left 1013470034 6:110455841-110455863 CCTTCTTCCATGTGAGGACACTG 0: 2
1: 14
2: 383
3: 1258
4: 3112
Right 1013470039 6:110455874-110455896 ATCCAAAGGATGCAGCAATAAGG 0: 1
1: 0
2: 18
3: 68
4: 280
1013470034_1013470036 -4 Left 1013470034 6:110455841-110455863 CCTTCTTCCATGTGAGGACACTG 0: 2
1: 14
2: 383
3: 1258
4: 3112
Right 1013470036 6:110455860-110455882 ACTGCATTTATCCCATCCAAAGG 0: 1
1: 0
2: 1
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013470034 Original CRISPR CAGTGTCCTCACATGGAAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr