ID: 1013472293

View in Genome Browser
Species Human (GRCh38)
Location 6:110476380-110476402
Sequence CACCCCGCGCAGTCGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472293_1013472299 1 Left 1013472293 6:110476380-110476402 CCGTGTCCCGACTGCGCGGGGTG 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1013472299 6:110476404-110476426 GGAGGAAGTGGAGATGTTTTCGG 0: 1
1: 0
2: 0
3: 52
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472293 Original CRISPR CACCCCGCGCAGTCGGGACA CGG (reversed) Intronic
900096079 1:940634-940656 GACCCTGCGCAGCCGGGACTGGG + Intronic
900269210 1:1778553-1778575 CACCCCGCGCGGGCGGGAGGCGG + Intronic
921205202 1:212842798-212842820 CACCACGCCCAGCCGAGACAGGG - Intronic
1063537655 10:6900830-6900852 CACCCCACACAGTAGGGCCAGGG - Intergenic
1067790538 10:49284293-49284315 CACCCCCCCAAGTGGGGACATGG + Intergenic
1076797074 10:132803590-132803612 CACCCCGTGCAGTCGGCTAATGG - Intergenic
1102015523 12:109645534-109645556 CACCCCAGGTGGTCGGGACATGG + Intergenic
1104626240 12:130358022-130358044 CACCCCGAGGGGTCGGGATAGGG + Intronic
1122183631 14:99972399-99972421 GTCCTCGCGCGGTCGGGACACGG - Intronic
1130906089 15:88241725-88241747 CACCCAGCGCACTGGGGAGAAGG + Intronic
1132551653 16:556219-556241 CGCCCCGGGCAGGCGGGAGAGGG - Intergenic
1137988814 16:53131541-53131563 CAGCCCCCGGGGTCGGGACACGG + Intronic
1140409729 16:74734481-74734503 GACCCCACACAGTCGGCACAAGG - Intronic
1146256020 17:31391902-31391924 CACCTCGCGCAGGCGGCGCACGG - Exonic
1146896443 17:36545196-36545218 CACCCCGCCCAGTCGGCCCCAGG - Intronic
1152336424 17:79701965-79701987 CACCCAGCGCAGACAGGAAAGGG + Intergenic
1152659698 17:81536556-81536578 CACCCCGCCCGGCCTGGACAGGG + Exonic
1161346062 19:3769429-3769451 CACACCAGGCAGTGGGGACACGG - Exonic
1166042815 19:40213654-40213676 CCCCCCGCTCGGTGGGGACACGG + Exonic
925379859 2:3417203-3417225 CACCCAGGGCAGGCCGGACATGG - Intronic
925510540 2:4620834-4620856 CACCGCGCCCAGCCGTGACATGG + Intergenic
927510769 2:23642611-23642633 CACACCGGGCAGTGTGGACACGG - Exonic
927679716 2:25131670-25131692 CACCGCGCGCAGGCAGGGCAGGG - Intronic
941858553 2:170254637-170254659 CACCCTGGGAAGTTGGGACAAGG - Intronic
1175524229 20:59622578-59622600 CACCCCTCGCAGCAGGCACACGG - Intronic
1179983951 21:44910886-44910908 CACCCCCTGCAGCAGGGACAGGG - Intronic
1180188514 21:46151862-46151884 CACCCCGGGCGGTCGGGCCTGGG - Intronic
1180915142 22:19480392-19480414 CACCCCACACCGTTGGGACAGGG - Intronic
1182282593 22:29225964-29225986 CACCCAGCGCAGTCTGGACTGGG - Intronic
1184199822 22:42960679-42960701 CACCCTTCGAAGCCGGGACAGGG + Intronic
961377377 3:126475823-126475845 CTCCGCGCGCAGTCGGGGCGGGG + Exonic
961559259 3:127717534-127717556 CACCTCGCCCAGTAGGGAGAAGG - Intronic
962198062 3:133380254-133380276 CACCAGGTGCAGGCGGGACAGGG - Exonic
962536593 3:136334656-136334678 CACCCAGGACAGTAGGGACATGG - Intronic
962919021 3:139934979-139935001 CCCCCTGCCCAGTCGGGACCGGG - Intergenic
966878422 3:184336373-184336395 CACCCTGAGCAGTGGGCACACGG - Intronic
972607739 4:40629812-40629834 CGCCCCACGCAGCCGGGACGCGG - Intronic
984263089 4:177465145-177465167 CACCGCGCCCAGCCGGCACAGGG + Intergenic
985576982 5:678101-678123 CACCCGGCTCAGCTGGGACATGG - Intronic
985591902 5:770154-770176 CACCCGGCTCAGCTGGGACATGG - Intergenic
988959680 5:36357483-36357505 CACACCGCACAGTGGGGACGTGG - Intergenic
1013472293 6:110476380-110476402 CACCCCGCGCAGTCGGGACACGG - Intronic
1013820907 6:114152782-114152804 CATCCCTCGCAGTAGAGACAGGG - Intronic
1017707737 6:157139495-157139517 CACCCCCTGCAGGCGGGCCAGGG - Intronic
1028198559 7:87934637-87934659 CTCCCCGCGCACTCGGGAAATGG - Intronic
1029189446 7:98761388-98761410 CTCCCAGCTCAGTGGGGACAAGG - Intergenic
1029192982 7:98784995-98785017 CACCACACCCAGCCGGGACATGG - Intergenic
1034489168 7:151383882-151383904 CTCCCCGTGCAGCCGGGGCATGG - Intronic
1035209723 7:157318850-157318872 CACCGTGCCCAGCCGGGACATGG - Intergenic
1040275425 8:46011368-46011390 CACCCCCTGCAGTGGGCACAGGG - Intergenic
1049269077 8:141684586-141684608 CACCCAGCACAGTGGGTACAAGG + Intergenic
1049532607 8:143161968-143161990 AACCCCCCGCAGTGGGGAAATGG + Intergenic
1057963962 9:99485292-99485314 TACCCAGAGCAGTGGGGACAAGG - Intergenic
1060854747 9:126906451-126906473 CACCACGCCCAGCCAGGACAAGG - Intergenic