ID: 1013472379

View in Genome Browser
Species Human (GRCh38)
Location 6:110476716-110476738
Sequence AGGGGCCAAGCGACGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472379_1013472387 -1 Left 1013472379 6:110476716-110476738 CCTCCCTCCGTCGCTTGGCCCCT 0: 1
1: 0
2: 0
3: 20
4: 301
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472379_1013472393 19 Left 1013472379 6:110476716-110476738 CCTCCCTCCGTCGCTTGGCCCCT 0: 1
1: 0
2: 0
3: 20
4: 301
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472379 Original CRISPR AGGGGCCAAGCGACGGAGGG AGG (reversed) Intergenic