ID: 1013472380

View in Genome Browser
Species Human (GRCh38)
Location 6:110476719-110476741
Sequence CCGAGGGGCCAAGCGACGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472380_1013472387 -4 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472380_1013472395 28 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472380_1013472393 16 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472380 Original CRISPR CCGAGGGGCCAAGCGACGGA GGG (reversed) Intergenic