ID: 1013472382

View in Genome Browser
Species Human (GRCh38)
Location 6:110476720-110476742
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472382_1013472395 27 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472382_1013472393 15 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472382_1013472387 -5 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472382 Original CRISPR ACCGAGGGGCCAAGCGACGG AGG (reversed) Intergenic