ID: 1013472386

View in Genome Browser
Species Human (GRCh38)
Location 6:110476736-110476758
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472386_1013472395 11 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472386_1013472401 27 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472386_1013472398 21 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472398 6:110476780-110476802 GCCTCCTTCCCGGCGCGCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 185
1013472386_1013472393 -1 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472386 Original CRISPR GAAGATACTTGGGGGGACCG AGG (reversed) Intergenic