ID: 1013472387

View in Genome Browser
Species Human (GRCh38)
Location 6:110476738-110476760
Sequence TCGGTCCCCCCAAGTATCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472379_1013472387 -1 Left 1013472379 6:110476716-110476738 CCTCCCTCCGTCGCTTGGCCCCT 0: 1
1: 0
2: 0
3: 20
4: 301
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472380_1013472387 -4 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472382_1013472387 -5 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472377_1013472387 22 Left 1013472377 6:110476693-110476715 CCAGCGCGAGGCTGTATTCTGTT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1013472383_1013472387 -8 Left 1013472383 6:110476723-110476745 CCGTCGCTTGGCCCCTCGGTCCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1013472387 6:110476738-110476760 TCGGTCCCCCCAAGTATCTTCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472387 Original CRISPR TCGGTCCCCCCAAGTATCTT CGG Intergenic