ID: 1013472389

View in Genome Browser
Species Human (GRCh38)
Location 6:110476744-110476766
Sequence AAAAAGCCGAAGATACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472389_1013472395 3 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472389_1013472398 13 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472398 6:110476780-110476802 GCCTCCTTCCCGGCGCGCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 185
1013472389_1013472404 28 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472389_1013472393 -9 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472389_1013472401 19 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472389 Original CRISPR AAAAAGCCGAAGATACTTGG GGG (reversed) Intergenic