ID: 1013472391

View in Genome Browser
Species Human (GRCh38)
Location 6:110476746-110476768
Sequence GAAAAAAGCCGAAGATACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472391_1013472395 1 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472391_1013472404 26 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472391_1013472398 11 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472398 6:110476780-110476802 GCCTCCTTCCCGGCGCGCTGTGG 0: 1
1: 0
2: 2
3: 15
4: 185
1013472391_1013472401 17 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472391 Original CRISPR GAAAAAAGCCGAAGATACTT GGG (reversed) Intergenic