ID: 1013472393

View in Genome Browser
Species Human (GRCh38)
Location 6:110476758-110476780
Sequence CGGCTTTTTTCCTGCCGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472389_1013472393 -9 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472379_1013472393 19 Left 1013472379 6:110476716-110476738 CCTCCCTCCGTCGCTTGGCCCCT 0: 1
1: 0
2: 0
3: 20
4: 301
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472384_1013472393 1 Left 1013472384 6:110476734-110476756 CCCCTCGGTCCCCCCAAGTATCT 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472382_1013472393 15 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472385_1013472393 0 Left 1013472385 6:110476735-110476757 CCCTCGGTCCCCCCAAGTATCTT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472390_1013472393 -10 Left 1013472390 6:110476745-110476767 CCCCAAGTATCTTCGGCTTTTTT 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472380_1013472393 16 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472386_1013472393 -1 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472388_1013472393 -8 Left 1013472388 6:110476743-110476765 CCCCCCAAGTATCTTCGGCTTTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1013472383_1013472393 12 Left 1013472383 6:110476723-110476745 CCGTCGCTTGGCCCCTCGGTCCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1013472393 6:110476758-110476780 CGGCTTTTTTCCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472393 Original CRISPR CGGCTTTTTTCCTGCCGCCT CGG Intergenic