ID: 1013472395

View in Genome Browser
Species Human (GRCh38)
Location 6:110476770-110476792
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 424}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472385_1013472395 12 Left 1013472385 6:110476735-110476757 CCCTCGGTCCCCCCAAGTATCTT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472380_1013472395 28 Left 1013472380 6:110476719-110476741 CCCTCCGTCGCTTGGCCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472392_1013472395 0 Left 1013472392 6:110476747-110476769 CCAAGTATCTTCGGCTTTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472383_1013472395 24 Left 1013472383 6:110476723-110476745 CCGTCGCTTGGCCCCTCGGTCCC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472388_1013472395 4 Left 1013472388 6:110476743-110476765 CCCCCCAAGTATCTTCGGCTTTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472391_1013472395 1 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472384_1013472395 13 Left 1013472384 6:110476734-110476756 CCCCTCGGTCCCCCCAAGTATCT 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472382_1013472395 27 Left 1013472382 6:110476720-110476742 CCTCCGTCGCTTGGCCCCTCGGT 0: 1
1: 0
2: 0
3: 5
4: 49
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472389_1013472395 3 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472386_1013472395 11 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424
1013472390_1013472395 2 Left 1013472390 6:110476745-110476767 CCCCAAGTATCTTCGGCTTTTTT 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1013472395 6:110476770-110476792 TGCCGCCTCGGCCTCCTTCCCGG 0: 1
1: 0
2: 2
3: 55
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472395 Original CRISPR TGCCGCCTCGGCCTCCTTCC CGG Intergenic