ID: 1013472399 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:110476781-110476803 |
| Sequence | ACCACAGCGCGCCGGGAAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 108 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 5, 4: 101} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1013472399_1013472405 | -1 | Left | 1013472399 | 6:110476781-110476803 | CCTCCTTCCCGGCGCGCTGTGGT | 0: 1 1: 0 2: 1 3: 5 4: 101 |
||
| Right | 1013472405 | 6:110476803-110476825 | TCCCGGCGCCCGCGGTCGCATGG | 0: 1 1: 0 2: 0 3: 4 4: 59 |
||||
| 1013472399_1013472404 | -9 | Left | 1013472399 | 6:110476781-110476803 | CCTCCTTCCCGGCGCGCTGTGGT | 0: 1 1: 0 2: 1 3: 5 4: 101 |
||
| Right | 1013472404 | 6:110476795-110476817 | CGCTGTGGTCCCGGCGCCCGCGG | 0: 1 1: 0 2: 1 3: 14 4: 161 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1013472399 | Original CRISPR | ACCACAGCGCGCCGGGAAGG AGG (reversed) | Intergenic | ||