ID: 1013472401

View in Genome Browser
Species Human (GRCh38)
Location 6:110476786-110476808
Sequence TTCCCGGCGCGCTGTGGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472392_1013472401 16 Left 1013472392 6:110476747-110476769 CCAAGTATCTTCGGCTTTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472384_1013472401 29 Left 1013472384 6:110476734-110476756 CCCCTCGGTCCCCCCAAGTATCT 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472391_1013472401 17 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472385_1013472401 28 Left 1013472385 6:110476735-110476757 CCCTCGGTCCCCCCAAGTATCTT 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472386_1013472401 27 Left 1013472386 6:110476736-110476758 CCTCGGTCCCCCCAAGTATCTTC 0: 1
1: 0
2: 0
3: 17
4: 96
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472388_1013472401 20 Left 1013472388 6:110476743-110476765 CCCCCCAAGTATCTTCGGCTTTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472389_1013472401 19 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472394_1013472401 -5 Left 1013472394 6:110476768-110476790 CCTGCCGCCTCGGCCTCCTTCCC 0: 1
1: 1
2: 7
3: 121
4: 1076
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472396_1013472401 -9 Left 1013472396 6:110476772-110476794 CCGCCTCGGCCTCCTTCCCGGCG 0: 1
1: 1
2: 1
3: 32
4: 414
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81
1013472390_1013472401 18 Left 1013472390 6:110476745-110476767 CCCCAAGTATCTTCGGCTTTTTT 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1013472401 6:110476786-110476808 TTCCCGGCGCGCTGTGGTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472401 Original CRISPR TTCCCGGCGCGCTGTGGTCC CGG Intergenic