ID: 1013472404

View in Genome Browser
Species Human (GRCh38)
Location 6:110476795-110476817
Sequence CGCTGTGGTCCCGGCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013472388_1013472404 29 Left 1013472388 6:110476743-110476765 CCCCCCAAGTATCTTCGGCTTTT 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472389_1013472404 28 Left 1013472389 6:110476744-110476766 CCCCCAAGTATCTTCGGCTTTTT 0: 1
1: 0
2: 0
3: 11
4: 141
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472394_1013472404 4 Left 1013472394 6:110476768-110476790 CCTGCCGCCTCGGCCTCCTTCCC 0: 1
1: 1
2: 7
3: 121
4: 1076
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472399_1013472404 -9 Left 1013472399 6:110476781-110476803 CCTCCTTCCCGGCGCGCTGTGGT 0: 1
1: 0
2: 1
3: 5
4: 101
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472391_1013472404 26 Left 1013472391 6:110476746-110476768 CCCAAGTATCTTCGGCTTTTTTC 0: 1
1: 0
2: 0
3: 8
4: 185
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472396_1013472404 0 Left 1013472396 6:110476772-110476794 CCGCCTCGGCCTCCTTCCCGGCG 0: 1
1: 1
2: 1
3: 32
4: 414
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472390_1013472404 27 Left 1013472390 6:110476745-110476767 CCCCAAGTATCTTCGGCTTTTTT 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472392_1013472404 25 Left 1013472392 6:110476747-110476769 CCAAGTATCTTCGGCTTTTTTCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161
1013472397_1013472404 -3 Left 1013472397 6:110476775-110476797 CCTCGGCCTCCTTCCCGGCGCGC 0: 1
1: 0
2: 5
3: 29
4: 239
Right 1013472404 6:110476795-110476817 CGCTGTGGTCCCGGCGCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013472404 Original CRISPR CGCTGTGGTCCCGGCGCCCG CGG Intergenic