ID: 1013475808

View in Genome Browser
Species Human (GRCh38)
Location 6:110506311-110506333
Sequence CTGGAAACAGAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013475808_1013475814 -4 Left 1013475808 6:110506311-110506333 CCTTCCTCCATCTCTGTTTCCAG No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013475808 Original CRISPR CTGGAAACAGAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr