ID: 1013475814

View in Genome Browser
Species Human (GRCh38)
Location 6:110506330-110506352
Sequence CCAGCAGGGAGCTGACCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013475805_1013475814 14 Left 1013475805 6:110506293-110506315 CCCGATACTGTTTGTCCTCCTTC No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data
1013475809_1013475814 -8 Left 1013475809 6:110506315-110506337 CCTCCATCTCTGTTTCCAGCAGG No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data
1013475804_1013475814 15 Left 1013475804 6:110506292-110506314 CCCCGATACTGTTTGTCCTCCTT No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data
1013475808_1013475814 -4 Left 1013475808 6:110506311-110506333 CCTTCCTCCATCTCTGTTTCCAG No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data
1013475807_1013475814 -1 Left 1013475807 6:110506308-110506330 CCTCCTTCCTCCATCTCTGTTTC No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data
1013475806_1013475814 13 Left 1013475806 6:110506294-110506316 CCGATACTGTTTGTCCTCCTTCC No data
Right 1013475814 6:110506330-110506352 CCAGCAGGGAGCTGACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013475814 Original CRISPR CCAGCAGGGAGCTGACCATG AGG Intergenic
No off target data available for this crispr