ID: 1013477056

View in Genome Browser
Species Human (GRCh38)
Location 6:110518305-110518327
Sequence CAATGAAGCTATTTTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013477056_1013477059 8 Left 1013477056 6:110518305-110518327 CCTGCCTTAAAATAGCTTCATTG No data
Right 1013477059 6:110518336-110518358 AAAATTTATCAGCCTCATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013477056 Original CRISPR CAATGAAGCTATTTTAAGGC AGG (reversed) Intergenic