ID: 1013479536

View in Genome Browser
Species Human (GRCh38)
Location 6:110542221-110542243
Sequence TAAAAGCTAAACCTCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013479535_1013479536 -10 Left 1013479535 6:110542208-110542230 CCTTTAGGCTCTTTAAAAGCTAA No data
Right 1013479536 6:110542221-110542243 TAAAAGCTAAACCTCTTGAGTGG No data
1013479534_1013479536 -2 Left 1013479534 6:110542200-110542222 CCAGGAATCCTTTAGGCTCTTTA No data
Right 1013479536 6:110542221-110542243 TAAAAGCTAAACCTCTTGAGTGG No data
1013479531_1013479536 11 Left 1013479531 6:110542187-110542209 CCCAACAGATAAGCCAGGAATCC No data
Right 1013479536 6:110542221-110542243 TAAAAGCTAAACCTCTTGAGTGG No data
1013479532_1013479536 10 Left 1013479532 6:110542188-110542210 CCAACAGATAAGCCAGGAATCCT No data
Right 1013479536 6:110542221-110542243 TAAAAGCTAAACCTCTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013479536 Original CRISPR TAAAAGCTAAACCTCTTGAG TGG Intergenic
No off target data available for this crispr